EMAIL THIS PAGE TO A FRIEND

RNASE10

ribonuclease, RNase A family, 10 (non-active)

49 Gene Product Result for
Synonyms: RNASE9
UniProtKB ID: Q5GAN6, A2RUQ3
Gene ID:
Mouse(75019) ribonuclease, RNase A family, 10 (non-active)
Rat(305840) ribonuclease, RNase A family, 10 (non-active)
Horse(100033972) ribonuclease, RNase A family, 10 (non-active)
domestic cat(101081471) ribonuclease, RNase A family, 10 (non-active)
dog(482560) ribonuclease, RNase A family, 10 (non-active)
cow(100140137) ribonuclease, RNase A family, 10 (non-active)
naked mole-rat(101713792) ribonuclease, RNase A family, 10 (non-active)
domestic guinea pig(100722277) ribonuclease, RNase A family, 10 (non-active)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012975 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012975 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012975 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029145 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029145 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029145 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_292225 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_292225 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_292225 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012975 Rosetta Predictions human pricing
NM_001012467 Rosetta Predictions rat pricing
NM_029145 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012975 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020661 predicted 386
2 SASI_Hs01_00020662 predicted 420
3 SASI_Hs02_00306275 predicted 338
4 SASI_Hs01_00020663 predicted 218
5 SASI_Hs01_00020665 predicted 316
6 SASI_Hs01_00020666 predicted 295
7 SASI_Hs01_00020667 predicted 319
8 SASI_Hs01_00020668 predicted 392
9 SASI_Hs01_00020669 predicted 340
10 SASI_Hs01_00020670 predicted 331
11 SASI_Hs01_00020664 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012467 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200571 predicted 307
2 SASI_Rn01_00033152 predicted 287
3 SASI_Rn01_00033153 predicted 303
4 SASI_Rn01_00033154 predicted 220
5 SASI_Rn01_00033156 predicted 394
6 SASI_Rn01_00033158 predicted 377
7 SASI_Rn01_00033159 predicted 315
8 SASI_Rn01_00033160 predicted 349
9 SASI_Rn01_00033161 predicted 382
10 SASI_Rn02_00200572 predicted 310
11 SASI_Rn01_00033155 predicted 396
12 SASI_Rn01_00033157 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029145 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334945 predicted 325
2 SASI_Mm01_00060536 predicted 889
3 SASI_Mm01_00060537 predicted 441
4 SASI_Mm01_00060538 predicted 248
5 SASI_Mm01_00060539 predicted 516
6 SASI_Mm01_00060540 predicted 513
7 SASI_Mm01_00060541 predicted 580
8 SASI_Mm01_00060542 predicted 737
9 SASI_Mm01_00060543 predicted 282
10 SASI_Mm02_00334946 predicted 1012
11 SASI_Mm01_00060534 predicted 1055
12 SASI_Mm01_00060535 predicted 1058
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012975
RNASE10 MISSION shRNA Bacterial Glycerol Stock
ribonuclease, RNase A family, 10 (non-active)
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000373377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012975.1-345s21c1
Sequence:CCGGAGATAGAGAATGCAATGATATCTCGAGATATCATTGCATTCTCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012975.1-109s21c1
Sequence:CCGGAGTGATCAACCGCTCAATGAACTCGAGTTCATTGAGCGGTTGATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012975.1-395s21c1
Sequence:CCGGAGAGTTGCATAGCCCAGTATGCTCGAGCATACTGGGCTATGCAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012975
RNASE10 MISSION shRNA shRNA Plasmid DNA
ribonuclease, RNase A family, 10 (non-active)
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000373377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012975.1-345s21c1
Sequence:CCGGAGATAGAGAATGCAATGATATCTCGAGATATCATTGCATTCTCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012975.1-109s21c1
Sequence:CCGGAGTGATCAACCGCTCAATGAACTCGAGTTCATTGAGCGGTTGATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012975.1-395s21c1
Sequence:CCGGAGAGTTGCATAGCCCAGTATGCTCGAGCATACTGGGCTATGCAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012975
RNASE10 MISSION shRNA Lentiviral Transduction Particles
ribonuclease, RNase A family, 10 (non-active)
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000373377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012975.1-345s21c1
Sequence:CCGGAGATAGAGAATGCAATGATATCTCGAGATATCATTGCATTCTCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012975.1-109s21c1
Sequence:CCGGAGTGATCAACCGCTCAATGAACTCGAGTTCATTGAGCGGTTGATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012975.1-395s21c1
Sequence:CCGGAGAGTTGCATAGCCCAGTATGCTCGAGCATACTGGGCTATGCAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029145
RNASE10 MISSION shRNA Bacterial Glycerol Stock
ribonuclease, RNase A family, 10 (non-active)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000119498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029145.1-128s1c1
Sequence:CCGGGCTGCTTACAAGTGTAGGCAACTCGAGTTGCCTACACTTGTAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029145.1-518s1c1
Sequence:CCGGGCCTAATCAGAGCTCCATAAACTCGAGTTTATGGAGCTCTGATTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119497    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029145.1-1150s1c1
Sequence:CCGGGCCTCCTTTATCTACCTCCTTCTCGAGAAGGAGGTAGATAAAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029145.1-699s1c1
Sequence:CCGGTGTCACTATCTGACTTACATACTCGAGTATGTAAGTCAGATAGTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029145
RNASE10 MISSION shRNA shRNA Plasmid DNA
ribonuclease, RNase A family, 10 (non-active)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000119498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029145.1-128s1c1
Sequence:CCGGGCTGCTTACAAGTGTAGGCAACTCGAGTTGCCTACACTTGTAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029145.1-518s1c1
Sequence:CCGGGCCTAATCAGAGCTCCATAAACTCGAGTTTATGGAGCTCTGATTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119497    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029145.1-1150s1c1
Sequence:CCGGGCCTCCTTTATCTACCTCCTTCTCGAGAAGGAGGTAGATAAAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029145.1-699s1c1
Sequence:CCGGTGTCACTATCTGACTTACATACTCGAGTATGTAAGTCAGATAGTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029145
RNASE10 MISSION shRNA Lentiviral Transduction Particles
ribonuclease, RNase A family, 10 (non-active)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000119498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029145.1-128s1c1
Sequence:CCGGGCTGCTTACAAGTGTAGGCAACTCGAGTTGCCTACACTTGTAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029145.1-518s1c1
Sequence:CCGGGCCTAATCAGAGCTCCATAAACTCGAGTTTATGGAGCTCTGATTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119497    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029145.1-1150s1c1
Sequence:CCGGGCCTCCTTTATCTACCTCCTTCTCGAGAAGGAGGTAGATAAAGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029145.1-699s1c1
Sequence:CCGGTGTCACTATCTGACTTACATACTCGAGTATGTAAGTCAGATAGTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_292225
RNASE10 MISSION shRNA Bacterial Glycerol Stock
ribonuclease, RNase A family, 10 (non-active)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292225.2-85s1c1
Sequence:CCGGGCTGCCCAAATCACTCAGTTACTCGAGTAACTGAGTGATTTGGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292225.2-958s1c1
Sequence:CCGGGAGGATCTAAACACAGTCAAACTCGAGTTTGACTGTGTTTAGATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292225.2-832s1c1
Sequence:CCGGGCTCTCTTTCAGAGCAACAAACTCGAGTTTGTTGCTCTGAAAGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292225.2-176s1c1
Sequence:CCGGGCCTGAACAGACTTTGTTTATCTCGAGATAAACAAAGTCTGTTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292225.2-511s1c1
Sequence:CCGGCTGGATAAAGTTATAGGCAAACTCGAGTTTGCCTATAACTTTATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_292225
RNASE10 MISSION shRNA shRNA Plasmid DNA
ribonuclease, RNase A family, 10 (non-active)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292225.2-85s1c1
Sequence:CCGGGCTGCCCAAATCACTCAGTTACTCGAGTAACTGAGTGATTTGGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292225.2-958s1c1
Sequence:CCGGGAGGATCTAAACACAGTCAAACTCGAGTTTGACTGTGTTTAGATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292225.2-832s1c1
Sequence:CCGGGCTCTCTTTCAGAGCAACAAACTCGAGTTTGTTGCTCTGAAAGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292225.2-176s1c1
Sequence:CCGGGCCTGAACAGACTTTGTTTATCTCGAGATAAACAAAGTCTGTTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292225.2-511s1c1
Sequence:CCGGCTGGATAAAGTTATAGGCAAACTCGAGTTTGCCTATAACTTTATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_292225
RNASE10 MISSION shRNA Lentiviral Transduction Particles
ribonuclease, RNase A family, 10 (non-active)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292225.2-85s1c1
Sequence:CCGGGCTGCCCAAATCACTCAGTTACTCGAGTAACTGAGTGATTTGGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292225.2-958s1c1
Sequence:CCGGGAGGATCTAAACACAGTCAAACTCGAGTTTGACTGTGTTTAGATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292225.2-832s1c1
Sequence:CCGGGCTCTCTTTCAGAGCAACAAACTCGAGTTTGTTGCTCTGAAAGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292225.2-176s1c1
Sequence:CCGGGCCTGAACAGACTTTGTTTATCTCGAGATAAACAAAGTCTGTTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292225.2-511s1c1
Sequence:CCGGCTGGATAAAGTTATAGGCAAACTCGAGTTTGCCTATAACTTTATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)