EMAIL THIS PAGE TO A FRIEND

RNASE11

ribonuclease, RNase A family, 11 (non-active)

83 Gene Product Result for
Synonyms: C14orf6
UniProtKB ID: Q8TAA1
Gene ID:
Mouse(497113) ribonuclease, RNase A family, 11 (non-active)
Rat(497651) ribonuclease, RNase A family, 11 (non-active)
domestic guinea pig(100718048) ribonuclease, RNase A family, 11 (non-active)
naked mole-rat(101707802) ribonuclease, RNase A family, 11 (non-active)
cow(783426) ribonuclease, RNase A family, 11 (non-active)
sheep(101116734) ribonuclease, RNase A family, 11 (non-active)
domestic cat(101081733) ribonuclease, RNase A family, 11 (non-active)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145250 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145250 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145250 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001011877 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001011877 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001011877 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040541 MISSION® esiRNA esiRNA human RNASE11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145250 Rosetta Predictions human pricing
NM_001012476 Rosetta Predictions rat pricing
NM_001011877 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145250 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174037 predicted 745
2 SASI_Hs01_00174038 predicted 701
3 SASI_Hs01_00174039 predicted 1240
4 SASI_Hs01_00174040 predicted 276
5 SASI_Hs01_00174041 predicted 1231
6 SASI_Hs02_00365093 predicted 1214
7 SASI_Hs02_00365094 predicted 441
8 SASI_Hs01_00174043 predicted 1228
9 SASI_Hs02_00365095 predicted 410
10 SASI_Hs02_00365096 predicted 322
11 SASI_Hs01_00174036 predicted 407
12 SASI_Hs01_00174042 predicted 245
13 SASI_Hs01_00174044 predicted 408
14 SASI_Hs01_00174045 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012476 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200584 predicted 775
2 SASI_Rn02_00200585 predicted 771
3 SASI_Rn02_00200586 predicted 876
4 SASI_Rn02_00200587 predicted 759
5 SASI_Rn01_00046000 predicted 382
6 SASI_Rn02_00200588 predicted 817
7 SASI_Rn02_00200589 predicted 465
8 SASI_Rn02_00200590 predicted 750
9 SASI_Rn02_00200591 predicted 564
10 SASI_Rn02_00200592 predicted 644
11 SASI_Rn01_00045994 predicted 319
12 SASI_Rn01_00045995 predicted 332
13 SASI_Rn01_00045996 predicted 319
14 SASI_Rn01_00045997 predicted 304
15 SASI_Rn01_00045998 predicted 208
16 SASI_Rn01_00045999 predicted 332
17 SASI_Rn01_00046001 predicted 295
18 SASI_Rn01_00046002 predicted 322
19 SASI_Rn01_00046003 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011877 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287059 predicted 313
2 SASI_Mm01_00036687 predicted 312
3 SASI_Mm02_00287060 predicted 254
4 SASI_Mm01_00036688 predicted 266
5 SASI_Mm01_00036690 predicted 316
6 SASI_Mm01_00036691 predicted 310
7 SASI_Mm01_00036692 predicted 203
8 SASI_Mm01_00036693 predicted 239
9 SASI_Mm01_00036694 predicted 304
10 SASI_Mm01_00036695 predicted 247
11 SASI_Mm01_00036689 predicted 261
12 SASI_Mm01_00036696 predicted 333
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145250
RNASE11 MISSION shRNA Bacterial Glycerol Stock
ribonuclease, RNase A family, 11 (non-active)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145250.3-1175s21c1
Sequence:CCGGGTGAATGAGTGTGACATATATCTCGAGATATATGTCACACTCATTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145250.1-383s1c1
Sequence:CCGGCGGGTAATGACAAAGAGTGTTCTCGAGAACACTCTTTGTCATTACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145250.1-683s1c1
Sequence:CCGGGCTGGTTAGTTTGTGGCTCTACTCGAGTAGAGCCACAAACTAACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145250.1-213s1c1
Sequence:CCGGGATGCAATATGACATGGCAAACTCGAGTTTGCCATGTCATATTGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145250.1-151s1c1
Sequence:CCGGGTTCTTGCAGAAGCATCAGAACTCGAGTTCTGATGCTTCTGCAAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145250.1-631s1c1
Sequence:CCGGGTTACCTCATTAGAGAAGATACTCGAGTATCTTCTCTAATGAGGTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145250.3-520s21c1
Sequence:CCGGATCGTGCAAGTGGAGCAATAACTCGAGTTATTGCTCCACTTGCACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373379    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145250.3-1044s21c1
Sequence:CCGGTCATCCTAGCTCAGCTATAAACTCGAGTTTATAGCTGAGCTAGGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145250
RNASE11 MISSION shRNA shRNA Plasmid DNA
ribonuclease, RNase A family, 11 (non-active)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145250.3-1175s21c1
Sequence:CCGGGTGAATGAGTGTGACATATATCTCGAGATATATGTCACACTCATTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145250.1-383s1c1
Sequence:CCGGCGGGTAATGACAAAGAGTGTTCTCGAGAACACTCTTTGTCATTACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145250.1-683s1c1
Sequence:CCGGGCTGGTTAGTTTGTGGCTCTACTCGAGTAGAGCCACAAACTAACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145250.1-213s1c1
Sequence:CCGGGATGCAATATGACATGGCAAACTCGAGTTTGCCATGTCATATTGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145250.1-151s1c1
Sequence:CCGGGTTCTTGCAGAAGCATCAGAACTCGAGTTCTGATGCTTCTGCAAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145250.1-631s1c1
Sequence:CCGGGTTACCTCATTAGAGAAGATACTCGAGTATCTTCTCTAATGAGGTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145250.3-520s21c1
Sequence:CCGGATCGTGCAAGTGGAGCAATAACTCGAGTTATTGCTCCACTTGCACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373379    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145250.3-1044s21c1
Sequence:CCGGTCATCCTAGCTCAGCTATAAACTCGAGTTTATAGCTGAGCTAGGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145250
RNASE11 MISSION shRNA Lentiviral Transduction Particles
ribonuclease, RNase A family, 11 (non-active)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145250.3-1175s21c1
Sequence:CCGGGTGAATGAGTGTGACATATATCTCGAGATATATGTCACACTCATTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145250.1-383s1c1
Sequence:CCGGCGGGTAATGACAAAGAGTGTTCTCGAGAACACTCTTTGTCATTACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145250.1-683s1c1
Sequence:CCGGGCTGGTTAGTTTGTGGCTCTACTCGAGTAGAGCCACAAACTAACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145250.1-213s1c1
Sequence:CCGGGATGCAATATGACATGGCAAACTCGAGTTTGCCATGTCATATTGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145250.1-151s1c1
Sequence:CCGGGTTCTTGCAGAAGCATCAGAACTCGAGTTCTGATGCTTCTGCAAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145250.1-631s1c1
Sequence:CCGGGTTACCTCATTAGAGAAGATACTCGAGTATCTTCTCTAATGAGGTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145250.3-520s21c1
Sequence:CCGGATCGTGCAAGTGGAGCAATAACTCGAGTTATTGCTCCACTTGCACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373379    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145250.3-1044s21c1
Sequence:CCGGTCATCCTAGCTCAGCTATAAACTCGAGTTTATAGCTGAGCTAGGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001011877
RNASE11 MISSION shRNA Bacterial Glycerol Stock
ribonuclease, RNase A family, 11 (non-active)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011877.1-124s1c1
Sequence:CCGGCTAGAGGAATCAGCAAACTCACTCGAGTGAGTTTGCTGATTCCTCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011877.1-384s21c1
Sequence:CCGGCCGAGGGAAGTGTGAACAAACCTCGAGGTTTGTTCACACTTCCCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011877.1-206s21c1
Sequence:CCGGTAACACCCAGAAGGCTATCTTCTCGAGAAGATAGCCTTCTGGGTGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011877.1-27s1c1
Sequence:CCGGCCTTGGACTGCTTCTTGCAAACTCGAGTTTGCAAGAAGCAGTCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011877.1-255s21c1
Sequence:CCGGAGATGGCAGGAACTGTGTAAACTCGAGTTTACACAGTTCCTGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011877.1-322s21c1
Sequence:CCGGCAGTTGGGCAATGACTTTATACTCGAGTATAAAGTCATTGCCCAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011877.1-164s21c1
Sequence:CCGGCTGGCCTCAGCATATCCAAACCTCGAGGTTTGGATATGCTGAGGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001011877
RNASE11 MISSION shRNA shRNA Plasmid DNA
ribonuclease, RNase A family, 11 (non-active)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011877.1-124s1c1
Sequence:CCGGCTAGAGGAATCAGCAAACTCACTCGAGTGAGTTTGCTGATTCCTCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011877.1-384s21c1
Sequence:CCGGCCGAGGGAAGTGTGAACAAACCTCGAGGTTTGTTCACACTTCCCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011877.1-206s21c1
Sequence:CCGGTAACACCCAGAAGGCTATCTTCTCGAGAAGATAGCCTTCTGGGTGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011877.1-27s1c1
Sequence:CCGGCCTTGGACTGCTTCTTGCAAACTCGAGTTTGCAAGAAGCAGTCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011877.1-255s21c1
Sequence:CCGGAGATGGCAGGAACTGTGTAAACTCGAGTTTACACAGTTCCTGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011877.1-322s21c1
Sequence:CCGGCAGTTGGGCAATGACTTTATACTCGAGTATAAAGTCATTGCCCAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011877.1-164s21c1
Sequence:CCGGCTGGCCTCAGCATATCCAAACCTCGAGGTTTGGATATGCTGAGGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001011877
RNASE11 MISSION shRNA Lentiviral Transduction Particles
ribonuclease, RNase A family, 11 (non-active)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011877.1-124s1c1
Sequence:CCGGCTAGAGGAATCAGCAAACTCACTCGAGTGAGTTTGCTGATTCCTCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011877.1-384s21c1
Sequence:CCGGCCGAGGGAAGTGTGAACAAACCTCGAGGTTTGTTCACACTTCCCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011877.1-206s21c1
Sequence:CCGGTAACACCCAGAAGGCTATCTTCTCGAGAAGATAGCCTTCTGGGTGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011877.1-27s1c1
Sequence:CCGGCCTTGGACTGCTTCTTGCAAACTCGAGTTTGCAAGAAGCAGTCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011877.1-255s21c1
Sequence:CCGGAGATGGCAGGAACTGTGTAAACTCGAGTTTACACAGTTCCTGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011877.1-322s21c1
Sequence:CCGGCAGTTGGGCAATGACTTTATACTCGAGTATAAAGTCATTGCCCAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011877.1-164s21c1
Sequence:CCGGCTGGCCTCAGCATATCCAAACCTCGAGGTTTGGATATGCTGAGGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)