EMAIL THIS PAGE TO A FRIEND

RNASE12

ribonuclease, RNase A family, 12 (non-active)

57 Gene Product Result for
UniProtKB ID: Q5GAN4
Gene ID:
Mouse(497106) ribonuclease, RNase A family, 12 (non-active)
Rat(364302) ribonuclease, RNase A family, 12 (non-active)
domestic cat(101081986) ribonuclease, RNase A family, 12 (non-active)
dog(100688089) ribonuclease, RNase A family, 12 (non-active)
cow(100297737) ribonuclease, RNase A family, 12 (non-active)
sheep(101116483) ribonuclease, RNase A family, 12 (non-active)
naked mole-rat(101707448) ribonuclease, RNase A family, 12 (non-active)
domestic guinea pig(100717760) ribonuclease, RNase A family, 12 (non-active)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024822 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001024822 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001024822 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001011875 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001011875 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001011875 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128711 MISSION® esiRNA esiRNA human RNASE12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024822 Rosetta Predictions human pricing
NM_001012209 Rosetta Predictions rat pricing
XM_573756 Rosetta Predictions rat pricing
NM_001011875 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024822 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057383 predicted 204
2 SASI_Hs01_00057384 predicted 200
3 SASI_Hs01_00057385 predicted 314
4 SASI_Hs01_00057386 predicted 411
5 SASI_Hs01_00057387 predicted 96
6 SASI_Hs01_00057388 predicted 316
7 SASI_Hs02_00307251 predicted 278
8 SASI_Hs01_00057389 predicted 246
9 SASI_Hs01_00057390 predicted 245
10 SASI_Hs02_00307252 predicted 155
11 SASI_Hs01_00057391 predicted 166
12 SASI_Hs01_00057392 predicted 57
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012209 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047251 predicted 203
2 SASI_Rn01_00047252 predicted 199
3 SASI_Rn01_00047254 predicted 196
4 SASI_Rn01_00047255 predicted 393
5 SASI_Rn01_00047256 predicted 120
6 SASI_Rn01_00047257 predicted 217
7 SASI_Rn01_00047258 predicted 251
8 SASI_Rn01_00047259 predicted 105
9 SASI_Rn02_00200454 predicted 148
10 SASI_Rn02_00200455 predicted 161
11 SASI_Rn01_00047250 predicted 217
12 SASI_Rn01_00047253 predicted 213
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573756 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00151956 predicted 895
2 SASI_Rn01_00151957 predicted 896
3 SASI_Rn01_00151958 predicted 895
4 SASI_Rn01_00151959 predicted 882
5 SASI_Rn01_00151960 predicted 787
6 SASI_Rn01_00151961 predicted 900
7 SASI_Rn01_00151962 predicted 882
8 SASI_Rn01_00151963 predicted 868
9 SASI_Rn01_00151964 predicted 893
10 SASI_Rn01_00151965 predicted 890
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011875 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088333 predicted 204
2 SASI_Mm01_00088334 predicted 205
3 SASI_Mm01_00088335 predicted 203
4 SASI_Mm01_00088336 predicted 195
5 SASI_Mm01_00088337 predicted 193
6 SASI_Mm01_00088338 predicted 203
7 SASI_Mm01_00088339 predicted 197
8 SASI_Mm01_00088340 predicted 192
9 SASI_Mm01_00088341 predicted 34
10 SASI_Mm01_00088342 predicted 249
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024822
RNASE12 MISSION shRNA Bacterial Glycerol Stock
ribonuclease, RNase A family, 12 (non-active)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-64s1c1
Sequence:CCGGGCAGTGATGTCAACTTTAGAACTCGAGTTCTAAAGTTGACATCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-150s1c1
Sequence:CCGGCATACAAAGAGTTATCAGGGACTCGAGTCCCTGATAACTCTTTGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-154s1c1
Sequence:CCGGCAAAGAGTTATCAGGGAACCTCTCGAGAGGTTCCCTGATAACTCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-169s1c1
Sequence:CCGGGAACCTGACCACACTTGTAAACTCGAGTTTACAAGTGTGGTCAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-132s1c1
Sequence:CCGGGTACTGCAACCACATGATCATCTCGAGATGATCATGTGGTTGCAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-58s1c1
Sequence:CCGGGATGAAGCAGTGATGTCAACTCTCGAGAGTTGACATCACTGCTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-137s1c1
Sequence:CCGGGCAACCACATGATCATACAAACTCGAGTTTGTATGATCATGTGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-292s1c1
Sequence:CCGGCAGAGTGAGACAAAGTTCAAACTCGAGTTTGAACTTTGTCTCACTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-287s1c1
Sequence:CCGGGCTTTCAGAGTGAGACAAAGTCTCGAGACTTTGTCTCACTCTGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-97s1c1
Sequence:CCGGGACTACCCTCAGAATGACGTTCTCGAGAACGTCATTCTGAGGGTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-91s1c1
Sequence:CCGGCATGTGGACTACCCTCAGAATCTCGAGATTCTGAGGGTAGTCCACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-288s1c1
Sequence:CCGGCTTTCAGAGTGAGACAAAGTTCTCGAGAACTTTGTCTCACTCTGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-141s1c1
Sequence:CCGGCCACATGATCATACAAAGAGTCTCGAGACTCTTTGTATGATCATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024822
RNASE12 MISSION shRNA shRNA Plasmid DNA
ribonuclease, RNase A family, 12 (non-active)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-64s1c1
Sequence:CCGGGCAGTGATGTCAACTTTAGAACTCGAGTTCTAAAGTTGACATCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-150s1c1
Sequence:CCGGCATACAAAGAGTTATCAGGGACTCGAGTCCCTGATAACTCTTTGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-154s1c1
Sequence:CCGGCAAAGAGTTATCAGGGAACCTCTCGAGAGGTTCCCTGATAACTCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-169s1c1
Sequence:CCGGGAACCTGACCACACTTGTAAACTCGAGTTTACAAGTGTGGTCAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-132s1c1
Sequence:CCGGGTACTGCAACCACATGATCATCTCGAGATGATCATGTGGTTGCAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-58s1c1
Sequence:CCGGGATGAAGCAGTGATGTCAACTCTCGAGAGTTGACATCACTGCTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-137s1c1
Sequence:CCGGGCAACCACATGATCATACAAACTCGAGTTTGTATGATCATGTGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-292s1c1
Sequence:CCGGCAGAGTGAGACAAAGTTCAAACTCGAGTTTGAACTTTGTCTCACTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-287s1c1
Sequence:CCGGGCTTTCAGAGTGAGACAAAGTCTCGAGACTTTGTCTCACTCTGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-97s1c1
Sequence:CCGGGACTACCCTCAGAATGACGTTCTCGAGAACGTCATTCTGAGGGTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-91s1c1
Sequence:CCGGCATGTGGACTACCCTCAGAATCTCGAGATTCTGAGGGTAGTCCACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-288s1c1
Sequence:CCGGCTTTCAGAGTGAGACAAAGTTCTCGAGAACTTTGTCTCACTCTGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-141s1c1
Sequence:CCGGCCACATGATCATACAAAGAGTCTCGAGACTCTTTGTATGATCATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024822
RNASE12 MISSION shRNA Lentiviral Transduction Particles
ribonuclease, RNase A family, 12 (non-active)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-64s1c1
Sequence:CCGGGCAGTGATGTCAACTTTAGAACTCGAGTTCTAAAGTTGACATCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-150s1c1
Sequence:CCGGCATACAAAGAGTTATCAGGGACTCGAGTCCCTGATAACTCTTTGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-154s1c1
Sequence:CCGGCAAAGAGTTATCAGGGAACCTCTCGAGAGGTTCCCTGATAACTCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-169s1c1
Sequence:CCGGGAACCTGACCACACTTGTAAACTCGAGTTTACAAGTGTGGTCAGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-132s1c1
Sequence:CCGGGTACTGCAACCACATGATCATCTCGAGATGATCATGTGGTTGCAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-58s1c1
Sequence:CCGGGATGAAGCAGTGATGTCAACTCTCGAGAGTTGACATCACTGCTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-137s1c1
Sequence:CCGGGCAACCACATGATCATACAAACTCGAGTTTGTATGATCATGTGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-292s1c1
Sequence:CCGGCAGAGTGAGACAAAGTTCAAACTCGAGTTTGAACTTTGTCTCACTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-287s1c1
Sequence:CCGGGCTTTCAGAGTGAGACAAAGTCTCGAGACTTTGTCTCACTCTGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-97s1c1
Sequence:CCGGGACTACCCTCAGAATGACGTTCTCGAGAACGTCATTCTGAGGGTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-91s1c1
Sequence:CCGGCATGTGGACTACCCTCAGAATCTCGAGATTCTGAGGGTAGTCCACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-288s1c1
Sequence:CCGGCTTTCAGAGTGAGACAAAGTTCTCGAGAACTTTGTCTCACTCTGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024822.1-141s1c1
Sequence:CCGGCCACATGATCATACAAAGAGTCTCGAGACTCTTTGTATGATCATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001011875
RNASE12 MISSION shRNA Bacterial Glycerol Stock
ribonuclease, RNase A family, 12 (non-active)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011875.1-120s1c1
Sequence:CCGGTCTGAGGTACTGCAACTACATCTCGAGATGTAGTTGCAGTACCTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011875.1-243s1c1
Sequence:CCGGCAAGAAGATGTCGTGCCCAAACTCGAGTTTGGGCACGACATCTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011875.1-69s1c1
Sequence:CCGGGCTGACGTCCATAGAACAATTCTCGAGAATTGTTCTATGGACGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011875.1-90s1c1
Sequence:CCGGGCATGTGGACTATCCTCAGAACTCGAGTTCTGAGGATAGTCCACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011875.1-257s1c1
Sequence:CCGGGCCCAAATGATTCTGACCTTTCTCGAGAAAGGTCAGAATCATTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001011875
RNASE12 MISSION shRNA shRNA Plasmid DNA
ribonuclease, RNase A family, 12 (non-active)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011875.1-120s1c1
Sequence:CCGGTCTGAGGTACTGCAACTACATCTCGAGATGTAGTTGCAGTACCTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011875.1-243s1c1
Sequence:CCGGCAAGAAGATGTCGTGCCCAAACTCGAGTTTGGGCACGACATCTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011875.1-69s1c1
Sequence:CCGGGCTGACGTCCATAGAACAATTCTCGAGAATTGTTCTATGGACGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011875.1-90s1c1
Sequence:CCGGGCATGTGGACTATCCTCAGAACTCGAGTTCTGAGGATAGTCCACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011875.1-257s1c1
Sequence:CCGGGCCCAAATGATTCTGACCTTTCTCGAGAAAGGTCAGAATCATTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001011875
RNASE12 MISSION shRNA Lentiviral Transduction Particles
ribonuclease, RNase A family, 12 (non-active)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011875.1-120s1c1
Sequence:CCGGTCTGAGGTACTGCAACTACATCTCGAGATGTAGTTGCAGTACCTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011875.1-243s1c1
Sequence:CCGGCAAGAAGATGTCGTGCCCAAACTCGAGTTTGGGCACGACATCTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011875.1-69s1c1
Sequence:CCGGGCTGACGTCCATAGAACAATTCTCGAGAATTGTTCTATGGACGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011875.1-90s1c1
Sequence:CCGGGCATGTGGACTATCCTCAGAACTCGAGTTCTGAGGATAGTCCACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011875.1-257s1c1
Sequence:CCGGGCCCAAATGATTCTGACCTTTCTCGAGAAAGGTCAGAATCATTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)