EMAIL THIS PAGE TO A FRIEND

RNASE13

ribonuclease, RNase A family, 13 (non-active)

47 Gene Product Result for
UniProtKB ID: Q5GAN3
Gene ID:
Mouse(497071) ribonuclease, RNase A family, 13 (non-active)
Rat(497194) ribonuclease, RNase A family, 13 (non-active)
domestic guinea pig(100715253) ribonuclease, RNase A family, 13 (non-active)
naked mole-rat(101716473) ribonuclease, RNase A family, 13 (non-active)
cow(539741) ribonuclease, RNase A family, 13 (non-active)
sheep(101110512) ribonuclease, RNase A family, 13 (non-active)
domestic cat(101084203) ribonuclease, RNase A family, 13 (non-active)
dog(100688712) ribonuclease, RNase A family, 13 (non-active)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301120 Anti-RNASE13 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012264 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012264 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012264 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001011687 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001011687 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001011687 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012264 Rosetta Predictions human pricing
NM_001012231 Rosetta Predictions rat pricing
NM_001011687 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012264 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064191 predicted 227
2 SASI_Hs01_00064192 predicted 750
3 SASI_Hs01_00064193 predicted 342
4 SASI_Hs01_00064194 predicted 558
5 SASI_Hs01_00064196 predicted 343
6 SASI_Hs01_00064197 predicted 243
7 SASI_Hs02_00306057 predicted 393
8 SASI_Hs01_00064198 predicted 557
9 SASI_Hs01_00064199 predicted 287
10 SASI_Hs01_00064200 predicted 777
11 SASI_Hs01_00064195 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012231 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035755 predicted 235
2 SASI_Rn01_00035756 predicted 235
3 SASI_Rn01_00035758 predicted 262
4 SASI_Rn01_00035759 predicted 75
5 SASI_Rn01_00035760 predicted 327
6 SASI_Rn01_00035761 predicted 183
7 SASI_Rn01_00035762 predicted 417
8 SASI_Rn01_00035763 predicted 80
9 SASI_Rn01_00035764 predicted 47
10 SASI_Rn02_00200496 predicted 418
11 SASI_Rn01_00035757 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011687 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068063 predicted 239
2 SASI_Mm01_00068064 predicted 201
3 SASI_Mm01_00068065 predicted 241
4 SASI_Mm01_00068067 predicted 355
5 SASI_Mm01_00068068 predicted 183
6 SASI_Mm01_00068069 predicted 154
7 SASI_Mm01_00068070 predicted 126
8 SASI_Mm01_00068071 predicted 422
9 SASI_Mm01_00068072 predicted 422
10 SASI_Mm02_00286943 predicted 79
11 SASI_Mm01_00068066 predicted 242
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012264
RNASE13 MISSION shRNA Bacterial Glycerol Stock
ribonuclease, RNase A family, 13 (non-active)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012264.1-78s1c1
Sequence:CCGGGATTGGCAGCAGGAACTTCTACTCGAGTAGAAGTTCCTGCTGCCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012264.1-165s1c1
Sequence:CCGGGATGTCCTATATGCGAGGCAACTCGAGTTGCCTCGCATATAGGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012264.1-107s1c1
Sequence:CCGGGCATTGACTATCCCAGGGTTACTCGAGTAACCCTGGGATAGTCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012264.1-243s1c1
Sequence:CCGGCATCCAGAAGTTCTGCAAGTACTCGAGTACTTGCAGAACTTCTGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012264.1-255s1c1
Sequence:CCGGCTGCAAGTATAGTGACAGCTTCTCGAGAAGCTGTCACTATACTTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012264.1-60s1c1
Sequence:CCGGCATGGACATCAAGATGCAGATCTCGAGATCTGCATCTTGATGTCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012264.1-204s1c1
Sequence:CCGGCCCAAAGATCCATTATGTGATCTCGAGATCACATAATGGATCTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012264.1-149s1c1
Sequence:CCGGGCTATTGTAATGGTCTGATGTCTCGAGACATCAGACCATTACAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012264.1-249s1c1
Sequence:CCGGGAAGTTCTGCAAGTATAGTGACTCGAGTCACTATACTTGCAGAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012264.1-199s1c1
Sequence:CCGGGATTGCCCAAAGATCCATTATCTCGAGATAATGGATCTTTGGGCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012264
RNASE13 MISSION shRNA shRNA Plasmid DNA
ribonuclease, RNase A family, 13 (non-active)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012264.1-78s1c1
Sequence:CCGGGATTGGCAGCAGGAACTTCTACTCGAGTAGAAGTTCCTGCTGCCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012264.1-165s1c1
Sequence:CCGGGATGTCCTATATGCGAGGCAACTCGAGTTGCCTCGCATATAGGACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012264.1-107s1c1
Sequence:CCGGGCATTGACTATCCCAGGGTTACTCGAGTAACCCTGGGATAGTCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012264.1-243s1c1
Sequence:CCGGCATCCAGAAGTTCTGCAAGTACTCGAGTACTTGCAGAACTTCTGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012264.1-255s1c1
Sequence:CCGGCTGCAAGTATAGTGACAGCTTCTCGAGAAGCTGTCACTATACTTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012264.1-60s1c1
Sequence:CCGGCATGGACATCAAGATGCAGATCTCGAGATCTGCATCTTGATGTCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012264.1-204s1c1
Sequence:CCGGCCCAAAGATCCATTATGTGATCTCGAGATCACATAATGGATCTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012264.1-149s1c1
Sequence:CCGGGCTATTGTAATGGTCTGATGTCTCGAGACATCAGACCATTACAATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012264.1-249s1c1
Sequence:CCGGGAAGTTCTGCAAGTATAGTGACTCGAGTCACTATACTTGCAGAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012264.1-199s1c1
Sequence:CCGGGATTGCCCAAAGATCCATTATCTCGAGATAATGGATCTTTGGGCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012264
RNASE13 MISSION shRNA Lentiviral Transduction Particles
ribonuclease, RNase A family, 13 (non-active)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012264.1-78s1c1
Sequence:CCGGGATTGGCAGCAGGAACTTCTACTCGAGTAGAAGTTCCTGCTGCCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012264.1-165s1c1
Sequence:CCGGGATGTCCTATATGCGAGGCAACTCGAGTTGCCTCGCATATAGGACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012264.1-107s1c1
Sequence:CCGGGCATTGACTATCCCAGGGTTACTCGAGTAACCCTGGGATAGTCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012264.1-243s1c1
Sequence:CCGGCATCCAGAAGTTCTGCAAGTACTCGAGTACTTGCAGAACTTCTGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012264.1-255s1c1
Sequence:CCGGCTGCAAGTATAGTGACAGCTTCTCGAGAAGCTGTCACTATACTTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012264.1-60s1c1
Sequence:CCGGCATGGACATCAAGATGCAGATCTCGAGATCTGCATCTTGATGTCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012264.1-204s1c1
Sequence:CCGGCCCAAAGATCCATTATGTGATCTCGAGATCACATAATGGATCTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012264.1-149s1c1
Sequence:CCGGGCTATTGTAATGGTCTGATGTCTCGAGACATCAGACCATTACAATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012264.1-249s1c1
Sequence:CCGGGAAGTTCTGCAAGTATAGTGACTCGAGTCACTATACTTGCAGAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012264.1-199s1c1
Sequence:CCGGGATTGCCCAAAGATCCATTATCTCGAGATAATGGATCTTTGGGCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001011687
RNASE13 MISSION shRNA Bacterial Glycerol Stock
ribonuclease, RNase A family, 13 (non-active)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011687.1-84s1c1
Sequence:CCGGCATCAAGAACTTCCGAACCTTCTCGAGAAGGTTCGGAAGTTCTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011687.1-198s1c1
Sequence:CCGGGTACTGCCCTAAGATCCACTACTCGAGTAGTGGATCTTAGGGCAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011687.1-69s1c1
Sequence:CCGGCACAATTCAGACGGCCATCAACTCGAGTTGATGGCCGTCTGAATTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011687.1-147s1c1
Sequence:CCGGCGGATACTGTAATGGCCTCATCTCGAGATGAGGCCATTACAGTATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011687.1-255s1c1
Sequence:CCGGCTGTAAATACAGCGAGAGCTTCTCGAGAAGCTCTCGCTGTATTTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001011687
RNASE13 MISSION shRNA shRNA Plasmid DNA
ribonuclease, RNase A family, 13 (non-active)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011687.1-84s1c1
Sequence:CCGGCATCAAGAACTTCCGAACCTTCTCGAGAAGGTTCGGAAGTTCTTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011687.1-198s1c1
Sequence:CCGGGTACTGCCCTAAGATCCACTACTCGAGTAGTGGATCTTAGGGCAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011687.1-69s1c1
Sequence:CCGGCACAATTCAGACGGCCATCAACTCGAGTTGATGGCCGTCTGAATTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011687.1-147s1c1
Sequence:CCGGCGGATACTGTAATGGCCTCATCTCGAGATGAGGCCATTACAGTATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011687.1-255s1c1
Sequence:CCGGCTGTAAATACAGCGAGAGCTTCTCGAGAAGCTCTCGCTGTATTTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001011687
RNASE13 MISSION shRNA Lentiviral Transduction Particles
ribonuclease, RNase A family, 13 (non-active)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011687.1-84s1c1
Sequence:CCGGCATCAAGAACTTCCGAACCTTCTCGAGAAGGTTCGGAAGTTCTTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011687.1-198s1c1
Sequence:CCGGGTACTGCCCTAAGATCCACTACTCGAGTAGTGGATCTTAGGGCAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011687.1-69s1c1
Sequence:CCGGCACAATTCAGACGGCCATCAACTCGAGTTGATGGCCGTCTGAATTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011687.1-147s1c1
Sequence:CCGGCGGATACTGTAATGGCCTCATCTCGAGATGAGGCCATTACAGTATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011687.1-255s1c1
Sequence:CCGGCTGTAAATACAGCGAGAGCTTCTCGAGAAGCTCTCGCTGTATTTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)