EMAIL THIS PAGE TO A FRIEND

RNASE1

ribonuclease, RNase A family, 1 (pancreatic)

96 Gene Product Result for
Synonyms: RIB1 RNS1
Gene ID:
Human(6035) Summary: This gene encodes a member of the pancreatic-type of secretory ribonucleases, a subset of the ribonuclease A superfamily. The encoded endonuclease cleaves internal phosphodiester RNA bonds on the 3'-side of pyrimidine bases. It prefers poly(C) as a substrate and hydrolyzes 2',3'-cyclic nucleotides, with a pH optimum near 8.0. The encoded protein is monomeric and more commonly acts to degrade ds-RNA over ss-RNA. Alternative splicing occurs at this locus and four transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
Mouse(19752) ribonuclease, RNase A family, 1 (pancreatic)
Rat(364304) ribonuclease, RNase A family, 1 (pancreatic)
naked mole-rat(101706346) ribonuclease, RNase A family, 1 (pancreatic)
cow(282340) ribonuclease, RNase A family, 1 (pancreatic)
sheep(101113761) ribonuclease, RNase A family, 1 (pancreatic)
cow(280930) ribonuclease, RNase A family, 1 (pancreatic)
fruit fly(5656971) Ribonuclease 1
dog(475395) ribonuclease, RNase A family, 1 (pancreatic)
domestic cat(101082663) ribonuclease, RNase A family, 1 (pancreatic)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002933 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002933 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002933 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011271 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011271 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011271 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU084151 MISSION® esiRNA esiRNA human RNASE1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002933 Rosetta Predictions human pricing
NM_198232 Rosetta Predictions human pricing
NM_198234 Rosetta Predictions human pricing
NM_198235 Rosetta Predictions human pricing
NM_001029904 Rosetta Predictions rat pricing
XM_001064795 Rosetta Predictions rat pricing
NM_011271 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200283 predicted 428
2 SASI_Hs01_00200284 predicted 514
3 SASI_Hs02_00334765 predicted 442
4 SASI_Hs01_00200285 predicted 430
5 SASI_Hs01_00200286 predicted 509
6 SASI_Hs01_00200287 predicted 528
7 SASI_Hs01_00200288 predicted 527
8 SASI_Hs01_00200289 predicted 526
9 SASI_Hs01_00200290 predicted 557
10 SASI_Hs01_00200291 predicted 383
11 SASI_Hs01_00200292 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110346 predicted 497
2 SASI_Hs01_00110347 predicted 581
3 SASI_Hs02_00371758 predicted 513
4 SASI_Hs01_00110348 predicted 493
5 SASI_Hs01_00110349 predicted 585
6 SASI_Hs01_00110350 predicted 599
7 SASI_Hs01_00110351 predicted 589
8 SASI_Hs01_00110352 predicted 598
9 SASI_Hs01_00110353 predicted 635
10 SASI_Hs01_00110354 predicted 447
11 SASI_Hs01_00110355 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198234 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243947 predicted 501
2 SASI_Hs01_00243948 predicted 577
3 SASI_Hs02_00371759 predicted 512
4 SASI_Hs01_00243949 predicted 497
5 SASI_Hs01_00243950 predicted 582
6 SASI_Hs01_00243951 predicted 599
7 SASI_Hs01_00243952 predicted 592
8 SASI_Hs01_00243953 predicted 599
9 SASI_Hs01_00243954 predicted 628
10 SASI_Hs01_00243955 predicted 449
11 SASI_Hs01_00243956 predicted 430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022412 predicted 512
2 SASI_Hs01_00022413 predicted 591
3 SASI_Hs02_00371760 predicted 520
4 SASI_Hs01_00022414 predicted 512
5 SASI_Hs01_00022415 predicted 591
6 SASI_Hs01_00022416 predicted 610
7 SASI_Hs01_00022417 predicted 603
8 SASI_Hs01_00022418 predicted 607
9 SASI_Hs01_00022419 predicted 642
10 SASI_Hs01_00022420 predicted 463
11 SASI_Hs01_00022421 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029904 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098265 predicted 517
2 SASI_Rn01_00098266 predicted 273
3 SASI_Rn01_00098267 predicted 549
4 SASI_Rn01_00098268 predicted 547
5 SASI_Rn01_00098269 predicted 260
6 SASI_Rn01_00098270 predicted 560
7 SASI_Rn01_00098271 predicted 528
8 SASI_Rn01_00098272 predicted 543
9 SASI_Rn01_00098273 predicted 292
10 SASI_Rn01_00098274 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064795 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00311777 predicted 449
2 SASI_Rn02_00311778 predicted 202
3 SASI_Rn02_00311779 predicted 483
4 SASI_Rn02_00311780 predicted 477
5 SASI_Rn02_00311781 predicted 197
6 SASI_Rn02_00311782 predicted 492
7 SASI_Rn02_00311783 predicted 462
8 SASI_Rn02_00311784 predicted 472
9 SASI_Rn02_00311785 predicted 221
10 SASI_Rn02_00311786 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011271 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042256 predicted 598
2 SASI_Mm01_00042257 predicted 423
3 SASI_Mm01_00042258 predicted 248
4 SASI_Mm01_00042259 predicted 280
5 SASI_Mm01_00042260 predicted 223
6 SASI_Mm01_00042261 predicted 197
7 SASI_Mm01_00042262 predicted 440
8 SASI_Mm01_00042263 predicted 745
9 SASI_Mm01_00042264 predicted 490
10 SASI_Mm02_00320304 predicted 736
11 SASI_Mm01_00042255 predicted 628
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002933
RNASE1 MISSION shRNA Bacterial Glycerol Stock
ribonuclease, RNase A family, 1 (pancreatic)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002933.3-255s1c1
Sequence:CCGGGCTCCACCTACTGTAACCAAACTCGAGTTTGGTTACAGTAGGTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002933.3-352s1c1
Sequence:CCGGCCAGAATGTCTGTTTCCAGGACTCGAGTCCTGGAAACAGACATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002933.3-308s1c1
Sequence:CCGGTGCAAACCAGTGAACACCTTTCTCGAGAAAGGTGTTCACTGGTTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002933.3-539s1c1
Sequence:CCGGCCAGTCCACTTTGATGCTTCTCTCGAGAGAAGCATCAAAGTGGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002933.3-503s1c1
Sequence:CCGGCACATCATTGTGGCCTGTGAACTCGAGTTCACAGGCCACAATGATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002933.4-208s21c1
Sequence:CCGGGAAATTCCAGCGGCAGCATATCTCGAGATATGCTGCCGCTGGAATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002933.4-574s21c1
Sequence:CCGGCTAAGGTCAGAGCAGCGAGATCTCGAGATCTCGCTGCTCTGACCTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002933.4-135s21c1
Sequence:CCGGTCCTTCTGCTTGTCCTGATACCTCGAGGTATCAGGACAAGCAGAAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002933
RNASE1 MISSION shRNA shRNA Plasmid DNA
ribonuclease, RNase A family, 1 (pancreatic)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002933.3-255s1c1
Sequence:CCGGGCTCCACCTACTGTAACCAAACTCGAGTTTGGTTACAGTAGGTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002933.3-352s1c1
Sequence:CCGGCCAGAATGTCTGTTTCCAGGACTCGAGTCCTGGAAACAGACATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002933.3-308s1c1
Sequence:CCGGTGCAAACCAGTGAACACCTTTCTCGAGAAAGGTGTTCACTGGTTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002933.3-539s1c1
Sequence:CCGGCCAGTCCACTTTGATGCTTCTCTCGAGAGAAGCATCAAAGTGGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002933.3-503s1c1
Sequence:CCGGCACATCATTGTGGCCTGTGAACTCGAGTTCACAGGCCACAATGATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002933.4-208s21c1
Sequence:CCGGGAAATTCCAGCGGCAGCATATCTCGAGATATGCTGCCGCTGGAATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002933.4-574s21c1
Sequence:CCGGCTAAGGTCAGAGCAGCGAGATCTCGAGATCTCGCTGCTCTGACCTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002933.4-135s21c1
Sequence:CCGGTCCTTCTGCTTGTCCTGATACCTCGAGGTATCAGGACAAGCAGAAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002933
RNASE1 MISSION shRNA Lentiviral Transduction Particles
ribonuclease, RNase A family, 1 (pancreatic)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002933.3-255s1c1
Sequence:CCGGGCTCCACCTACTGTAACCAAACTCGAGTTTGGTTACAGTAGGTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002933.3-352s1c1
Sequence:CCGGCCAGAATGTCTGTTTCCAGGACTCGAGTCCTGGAAACAGACATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002933.3-308s1c1
Sequence:CCGGTGCAAACCAGTGAACACCTTTCTCGAGAAAGGTGTTCACTGGTTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002933.3-539s1c1
Sequence:CCGGCCAGTCCACTTTGATGCTTCTCTCGAGAGAAGCATCAAAGTGGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002933.3-503s1c1
Sequence:CCGGCACATCATTGTGGCCTGTGAACTCGAGTTCACAGGCCACAATGATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002933.4-208s21c1
Sequence:CCGGGAAATTCCAGCGGCAGCATATCTCGAGATATGCTGCCGCTGGAATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002933.4-574s21c1
Sequence:CCGGCTAAGGTCAGAGCAGCGAGATCTCGAGATCTCGCTGCTCTGACCTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002933.4-135s21c1
Sequence:CCGGTCCTTCTGCTTGTCCTGATACCTCGAGGTATCAGGACAAGCAGAAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011271
RNASE1 MISSION shRNA Bacterial Glycerol Stock
ribonuclease, RNase A family, 1 (pancreatic)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000066943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011271.2-512s1c1
Sequence:CCGGCCACTTTGATGCTACTGTGTACTCGAGTACACAGTAGCATCAAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011271.2-114s1c1
Sequence:CCGGCCATTGTTTGTCCTGCTGCTTCTCGAGAAGCAGCAGGACAAACAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011271.2-227s1c1
Sequence:CCGGCACCTACTGCAACCAAATGATCTCGAGATCATTTGGTTGCAGTAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011271.2-431s1c1
Sequence:CCGGGTATCCCAACTGTGACTACAACTCGAGTTGTAGTCACAGTTGGGATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011271
RNASE1 MISSION shRNA shRNA Plasmid DNA
ribonuclease, RNase A family, 1 (pancreatic)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000066943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011271.2-512s1c1
Sequence:CCGGCCACTTTGATGCTACTGTGTACTCGAGTACACAGTAGCATCAAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011271.2-114s1c1
Sequence:CCGGCCATTGTTTGTCCTGCTGCTTCTCGAGAAGCAGCAGGACAAACAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011271.2-227s1c1
Sequence:CCGGCACCTACTGCAACCAAATGATCTCGAGATCATTTGGTTGCAGTAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011271.2-431s1c1
Sequence:CCGGGTATCCCAACTGTGACTACAACTCGAGTTGTAGTCACAGTTGGGATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011271
RNASE1 MISSION shRNA Lentiviral Transduction Particles
ribonuclease, RNase A family, 1 (pancreatic)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000066943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011271.2-512s1c1
Sequence:CCGGCCACTTTGATGCTACTGTGTACTCGAGTACACAGTAGCATCAAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011271.2-114s1c1
Sequence:CCGGCCATTGTTTGTCCTGCTGCTTCTCGAGAAGCAGCAGGACAAACAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011271.2-227s1c1
Sequence:CCGGCACCTACTGCAACCAAATGATCTCGAGATCATTTGGTTGCAGTAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011271.2-431s1c1
Sequence:CCGGGTATCCCAACTGTGACTACAACTCGAGTTGTAGTCACAGTTGGGATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)