EMAIL THIS PAGE TO A FRIEND

RNASE3

ribonuclease, RNase A family, 3

32 Gene Product Result for
Synonyms: ECP RNS3
UniProtKB ID: P12724, Q4VBC1, Q8WTP7, Q8WZ62, Q9GZN9
Gene ID:
cow(100125948) ribonuclease, RNase A family, 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002935 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002935 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002935 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU011441 MISSION® esiRNA esiRNA targeting human RNASE3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002935 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002935 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151095 predicted 334
2 SASI_Hs01_00151096 predicted 445
3 SASI_Hs01_00151097 predicted 442
4 SASI_Hs02_00334767 predicted 196
5 SASI_Hs01_00151098 predicted 333
6 SASI_Hs01_00151099 predicted 327
7 SASI_Hs02_00334768 predicted 197
8 SASI_Hs01_00151103 predicted 349
9 SASI_Hs01_00151104 predicted 386
10 SASI_Hs02_00334769 predicted 368
11 SASI_Hs01_00151100 predicted 214
12 SASI_Hs01_00151101 predicted 319
13 SASI_Hs01_00151102 predicted 392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002935
RNASE3 MISSION shRNA Bacterial Glycerol Stock
ribonuclease, RNase A family, 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002935.2-206s1c1
Sequence:CCGGCCATTGCAATGCGGGCAATTACTCGAGTAATTGCCCGCATTGCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002935.2-376s1c1
Sequence:CCGGCTCCACTGTGACCTCATAAATCTCGAGATTTATGAGGTCACAGTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002935.2-295s1c1
Sequence:CCGGGTTTGTGGTAACCAAAGTATACTCGAGTATACTTTGGTTACCACAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002935.2-481s1c1
Sequence:CCGGCCACGGGATTCTCCACGGTATCTCGAGATACCGTGGAGAATCCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002935.2-321s1c1
Sequence:CCGGCCCTCATAACAGAACTCTCAACTCGAGTTGAGAGTTCTGTTATGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002935.2-437s21c1
Sequence:CCGGGACCAGGAAGGAGGTTCTATGCTCGAGCATAGAACCTCCTTCCTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002935.2-228s21c1
Sequence:CCGGCAATTATCGATGGCGTTGCAACTCGAGTTGCAACGCCATCGATAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002935.2-354s21c1
Sequence:CCGGGAGTAGATTCCGGGTGCCTTTCTCGAGAAAGGCACCCGGAATCTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002935
RNASE3 MISSION shRNA shRNA Plasmid DNA
ribonuclease, RNase A family, 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002935.2-206s1c1
Sequence:CCGGCCATTGCAATGCGGGCAATTACTCGAGTAATTGCCCGCATTGCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002935.2-376s1c1
Sequence:CCGGCTCCACTGTGACCTCATAAATCTCGAGATTTATGAGGTCACAGTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002935.2-295s1c1
Sequence:CCGGGTTTGTGGTAACCAAAGTATACTCGAGTATACTTTGGTTACCACAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002935.2-481s1c1
Sequence:CCGGCCACGGGATTCTCCACGGTATCTCGAGATACCGTGGAGAATCCCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002935.2-321s1c1
Sequence:CCGGCCCTCATAACAGAACTCTCAACTCGAGTTGAGAGTTCTGTTATGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002935.2-437s21c1
Sequence:CCGGGACCAGGAAGGAGGTTCTATGCTCGAGCATAGAACCTCCTTCCTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002935.2-228s21c1
Sequence:CCGGCAATTATCGATGGCGTTGCAACTCGAGTTGCAACGCCATCGATAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002935.2-354s21c1
Sequence:CCGGGAGTAGATTCCGGGTGCCTTTCTCGAGAAAGGCACCCGGAATCTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002935
RNASE3 MISSION shRNA Lentiviral Transduction Particles
ribonuclease, RNase A family, 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002935.2-206s1c1
Sequence:CCGGCCATTGCAATGCGGGCAATTACTCGAGTAATTGCCCGCATTGCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002935.2-376s1c1
Sequence:CCGGCTCCACTGTGACCTCATAAATCTCGAGATTTATGAGGTCACAGTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002935.2-295s1c1
Sequence:CCGGGTTTGTGGTAACCAAAGTATACTCGAGTATACTTTGGTTACCACAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002935.2-481s1c1
Sequence:CCGGCCACGGGATTCTCCACGGTATCTCGAGATACCGTGGAGAATCCCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002935.2-321s1c1
Sequence:CCGGCCCTCATAACAGAACTCTCAACTCGAGTTGAGAGTTCTGTTATGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002935.2-437s21c1
Sequence:CCGGGACCAGGAAGGAGGTTCTATGCTCGAGCATAGAACCTCCTTCCTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002935.2-228s21c1
Sequence:CCGGCAATTATCGATGGCGTTGCAACTCGAGTTGCAACGCCATCGATAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002935.2-354s21c1
Sequence:CCGGGAGTAGATTCCGGGTGCCTTTCTCGAGAAAGGCACCCGGAATCTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)