EMAIL THIS PAGE TO A FRIEND

RNASE4

ribonuclease, RNase A family, 4

135 Gene Product Result for
Synonyms: RNS4
UniProtKB ID: P34096
Gene ID:
Human(6038) Summary: The protein encoded by this gene belongs to the pancreatic ribonuclease family. It plays an important role in mRNA cleavage and has marked specificity towards the 3' side of uridine nucleotides. Alternative splicing results in two transcript variants encoding the same protein. This gene and the gene that encodes angiogenin share promoters and 5' exons. Each gene splices to a unique downstream exon that contains its complete coding region. [provided by RefSeq, Jul 2008]
Mouse(58809) ribonuclease, RNase A family 4
Rat(56759) ribonuclease, RNase A family 4
cow(616089) ribonuclease, RNase A family, 4
sheep(101114275) ribonuclease, RNase A family, 4
domestic guinea pig(100717485) ribonuclease, RNase A family, 4
naked mole-rat(101707085) ribonuclease, RNase A family, 4
dog(611048) ribonuclease, RNase A family, 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1104141 Anti-RNASE4 (33-46) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021472 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021472 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021472 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002937 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002937 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002937 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002937 Rosetta Predictions human pricing
NM_194430 Rosetta Predictions human pricing
NM_194431 Rosetta Predictions human pricing
NM_020082 Rosetta Predictions rat pricing
NM_021472 Rosetta Predictions mouse pricing
NM_201239 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334775 predicted 1160
2 SASI_Hs01_00041068 predicted 1129
3 SASI_Hs01_00041069 predicted 994
4 SASI_Hs01_00041071 predicted 1120
5 SASI_Hs01_00041072 predicted 1030
6 SASI_Hs01_00041073 predicted 883
7 SASI_Hs01_00041075 predicted 1041
8 SASI_Hs01_00041076 predicted 1028
9 SASI_Hs02_00334776 predicted 867
10 SASI_Hs02_00334777 predicted 768
11 SASI_Hs01_00041067 predicted 855
12 SASI_Hs01_00041070 predicted 1052
13 SASI_Hs01_00041074 predicted 1047
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023151 predicted 1268
2 SASI_Hs01_00023152 predicted 956
3 SASI_Hs01_00023153 predicted 1111
4 SASI_Hs01_00023154 predicted 1157
5 SASI_Hs01_00023155 predicted 1233
6 SASI_Hs01_00023156 predicted 1140
7 SASI_Hs01_00023157 predicted 991
8 SASI_Hs01_00023158 predicted 1145
9 SASI_Hs01_00023159 predicted 1151
10 SASI_Hs01_00023160 predicted 1141
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109522 predicted 715
2 SASI_Hs02_00371497 predicted 685
3 SASI_Hs01_00109524 predicted 555
4 SASI_Hs01_00109526 predicted 679
5 SASI_Hs01_00109527 predicted 589
6 SASI_Hs01_00109528 predicted 437
7 SASI_Hs01_00109530 predicted 598
8 SASI_Hs01_00109531 predicted 578
9 SASI_Hs02_00371498 predicted 425
10 SASI_Hs02_00371499 predicted 333
11 SASI_Hs01_00109523 predicted 405
12 SASI_Hs01_00109525 predicted 613
13 SASI_Hs01_00109529 predicted 597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020082 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121645 predicted 716
2 SASI_Rn01_00121646 predicted 618
3 SASI_Rn01_00121647 predicted 727
4 SASI_Rn01_00121648 predicted 330
5 SASI_Rn01_00121649 predicted 453
6 SASI_Rn01_00121650 predicted 598
7 SASI_Rn01_00121651 predicted 745
8 SASI_Rn01_00121652 predicted 206
9 SASI_Rn01_00121653 predicted 487
10 SASI_Rn02_00262491 predicted 799
11 SASI_Rn01_00121654 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021472 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143002 predicted 325
2 SASI_Mm01_00143003 predicted 626
3 SASI_Mm01_00143004 predicted 360
4 SASI_Mm01_00143005 predicted 610
5 SASI_Mm01_00143006 predicted 527
6 SASI_Mm01_00143007 predicted 446
7 SASI_Mm01_00143008 predicted 459
8 SASI_Mm01_00143009 predicted 296
9 SASI_Mm02_00326154 predicted 558
10 SASI_Mm01_00143011 predicted 490
11 SASI_Mm01_00143010 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201239 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166361 predicted 346
2 SASI_Mm01_00166362 predicted 641
3 SASI_Mm01_00166363 predicted 377
4 SASI_Mm01_00166364 predicted 623
5 SASI_Mm01_00166365 predicted 539
6 SASI_Mm01_00166366 predicted 470
7 SASI_Mm01_00166367 predicted 475
8 SASI_Mm01_00166368 predicted 308
9 SASI_Mm02_00351494 predicted 568
10 SASI_Mm01_00166370 predicted 508
11 SASI_Mm01_00166369 predicted 637
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021472
VALIDATED
RNASE4 MISSION shRNA Bacterial Glycerol Stock
ribonuclease, RNase A family, 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021472.4-285s21c1
Sequence:CCGGCGAATGTACCAACGGTTCCTTCTCGAGAAGGAACCGTTGGTACATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021472.4-617s21c1
Sequence:CCGGCCCAGTGCACTTTGACAGATACTCGAGTATCTGTCAAAGTGCACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021472.4-730s21c1
Sequence:CCGGCGTGCCTTATACTCACATATACTCGAGTATATGTGAGTATAAGGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021472.4-443s21c1
Sequence:CCGGCATCTGCAGTACCACCAATATCTCGAGATATTGGTGGTACTGCAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021472.2-297s1c1
Sequence:CCGGCCACGAAGACATCTGGAACATCTCGAGATGTTCCAGATGTCTTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021472.2-611s1c1
Sequence:CCGGCGTGCCTTATACTCACATATACTCGAGTATATGTGAGTATAAGGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021472.2-428s1c1
Sequence:CCGGCCAACTGTAGATACAGGGCAACTCGAGTTGCCCTGTATCTACAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021472.2-498s1c1
Sequence:CCGGCCCAGTGCACTTTGACAGATACTCGAGTATCTGTCAAAGTGCACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021472.2-166s1c1
Sequence:CCGGCGAATGTACCAACGGTTCCTTCTCGAGAAGGAACCGTTGGTACATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021472
VALIDATED
RNASE4 MISSION shRNA shRNA Plasmid DNA
ribonuclease, RNase A family, 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021472.4-285s21c1
Sequence:CCGGCGAATGTACCAACGGTTCCTTCTCGAGAAGGAACCGTTGGTACATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021472.4-617s21c1
Sequence:CCGGCCCAGTGCACTTTGACAGATACTCGAGTATCTGTCAAAGTGCACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021472.4-730s21c1
Sequence:CCGGCGTGCCTTATACTCACATATACTCGAGTATATGTGAGTATAAGGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021472.4-443s21c1
Sequence:CCGGCATCTGCAGTACCACCAATATCTCGAGATATTGGTGGTACTGCAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021472.2-297s1c1
Sequence:CCGGCCACGAAGACATCTGGAACATCTCGAGATGTTCCAGATGTCTTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021472.2-611s1c1
Sequence:CCGGCGTGCCTTATACTCACATATACTCGAGTATATGTGAGTATAAGGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021472.2-428s1c1
Sequence:CCGGCCAACTGTAGATACAGGGCAACTCGAGTTGCCCTGTATCTACAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021472.2-498s1c1
Sequence:CCGGCCCAGTGCACTTTGACAGATACTCGAGTATCTGTCAAAGTGCACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021472.2-166s1c1
Sequence:CCGGCGAATGTACCAACGGTTCCTTCTCGAGAAGGAACCGTTGGTACATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021472
VALIDATED
RNASE4 MISSION shRNA Lentiviral Transduction Particles
ribonuclease, RNase A family, 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021472.4-285s21c1
Sequence:CCGGCGAATGTACCAACGGTTCCTTCTCGAGAAGGAACCGTTGGTACATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021472.4-617s21c1
Sequence:CCGGCCCAGTGCACTTTGACAGATACTCGAGTATCTGTCAAAGTGCACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021472.4-730s21c1
Sequence:CCGGCGTGCCTTATACTCACATATACTCGAGTATATGTGAGTATAAGGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021472.4-443s21c1
Sequence:CCGGCATCTGCAGTACCACCAATATCTCGAGATATTGGTGGTACTGCAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021472.2-297s1c1
Sequence:CCGGCCACGAAGACATCTGGAACATCTCGAGATGTTCCAGATGTCTTCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021472.2-611s1c1
Sequence:CCGGCGTGCCTTATACTCACATATACTCGAGTATATGTGAGTATAAGGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021472.2-428s1c1
Sequence:CCGGCCAACTGTAGATACAGGGCAACTCGAGTTGCCCTGTATCTACAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021472.2-498s1c1
Sequence:CCGGCCCAGTGCACTTTGACAGATACTCGAGTATCTGTCAAAGTGCACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021472.2-166s1c1
Sequence:CCGGCGAATGTACCAACGGTTCCTTCTCGAGAAGGAACCGTTGGTACATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002937
VALIDATED
RNASE4 MISSION shRNA Bacterial Glycerol Stock
ribonuclease, RNase A family, 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002937.3-785s21c1
Sequence:CCGGCCATGAAGATATCTGGAACATCTCGAGATGTTCCAGATATCTTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002937.3-710s21c1
Sequence:CCGGTGATCGCTACTGCAACTTGATCTCGAGATCAAGTTGCAGTAGCGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002937.3-728s21c1
Sequence:CCGGGATGATGCAAAGACGGAAGATCTCGAGATCTTCCGTCTTTGCATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002937.3-941s21c1
Sequence:CCGGGAGCACTAGACGTGTTGTCATCTCGAGATGACAACACGTCTAGTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002937.3-833s21c1
Sequence:CCGGCCAATGCAAGAACGGCAAGATCTCGAGATCTTGCCGTTCTTGCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002937.3-833s1c1
Sequence:CCGGCCAATGCAAGAACGGCAAGATCTCGAGATCTTGCCGTTCTTGCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002937.3-710s1c1
Sequence:CCGGTGATCGCTACTGCAACTTGATCTCGAGATCAAGTTGCAGTAGCGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002937.3-785s1c1
Sequence:CCGGCCATGAAGATATCTGGAACATCTCGAGATGTTCCAGATATCTTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002937.3-941s1c1
Sequence:CCGGGAGCACTAGACGTGTTGTCATCTCGAGATGACAACACGTCTAGTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002937.3-728s1c1
Sequence:CCGGGATGATGCAAAGACGGAAGATCTCGAGATCTTCCGTCTTTGCATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002937
VALIDATED
RNASE4 MISSION shRNA shRNA Plasmid DNA
ribonuclease, RNase A family, 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002937.3-785s21c1
Sequence:CCGGCCATGAAGATATCTGGAACATCTCGAGATGTTCCAGATATCTTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002937.3-710s21c1
Sequence:CCGGTGATCGCTACTGCAACTTGATCTCGAGATCAAGTTGCAGTAGCGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002937.3-728s21c1
Sequence:CCGGGATGATGCAAAGACGGAAGATCTCGAGATCTTCCGTCTTTGCATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002937.3-941s21c1
Sequence:CCGGGAGCACTAGACGTGTTGTCATCTCGAGATGACAACACGTCTAGTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002937.3-833s21c1
Sequence:CCGGCCAATGCAAGAACGGCAAGATCTCGAGATCTTGCCGTTCTTGCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002937.3-833s1c1
Sequence:CCGGCCAATGCAAGAACGGCAAGATCTCGAGATCTTGCCGTTCTTGCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002937.3-710s1c1
Sequence:CCGGTGATCGCTACTGCAACTTGATCTCGAGATCAAGTTGCAGTAGCGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002937.3-785s1c1
Sequence:CCGGCCATGAAGATATCTGGAACATCTCGAGATGTTCCAGATATCTTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002937.3-941s1c1
Sequence:CCGGGAGCACTAGACGTGTTGTCATCTCGAGATGACAACACGTCTAGTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002937.3-728s1c1
Sequence:CCGGGATGATGCAAAGACGGAAGATCTCGAGATCTTCCGTCTTTGCATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002937
VALIDATED
RNASE4 MISSION shRNA Lentiviral Transduction Particles
ribonuclease, RNase A family, 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002937.3-785s21c1
Sequence:CCGGCCATGAAGATATCTGGAACATCTCGAGATGTTCCAGATATCTTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002937.3-710s21c1
Sequence:CCGGTGATCGCTACTGCAACTTGATCTCGAGATCAAGTTGCAGTAGCGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002937.3-728s21c1
Sequence:CCGGGATGATGCAAAGACGGAAGATCTCGAGATCTTCCGTCTTTGCATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002937.3-941s21c1
Sequence:CCGGGAGCACTAGACGTGTTGTCATCTCGAGATGACAACACGTCTAGTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002937.3-833s21c1
Sequence:CCGGCCAATGCAAGAACGGCAAGATCTCGAGATCTTGCCGTTCTTGCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002937.3-833s1c1
Sequence:CCGGCCAATGCAAGAACGGCAAGATCTCGAGATCTTGCCGTTCTTGCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002937.3-710s1c1
Sequence:CCGGTGATCGCTACTGCAACTTGATCTCGAGATCAAGTTGCAGTAGCGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002937.3-785s1c1
Sequence:CCGGCCATGAAGATATCTGGAACATCTCGAGATGTTCCAGATATCTTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002937.3-941s1c1
Sequence:CCGGGAGCACTAGACGTGTTGTCATCTCGAGATGACAACACGTCTAGTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002937.3-728s1c1
Sequence:CCGGGATGATGCAAAGACGGAAGATCTCGAGATCTTCCGTCTTTGCATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)