EMAIL THIS PAGE TO A FRIEND

RNASE6

ribonuclease, RNase A family, k6

59 Gene Product Result for
Synonyms: RNS6 RNasek6
UniProtKB ID: Q93091
Gene ID:
Mouse(78416) ribonuclease, RNase A family, 6
Rat(305842) ribonuclease, RNase A family, 6
naked mole-rat(101706720) ribonuclease, RNase A family, k6
cow(282341) ribonuclease, RNase A family, k6
Goat(100861262) ribonuclease, RNase A family, k6
sheep(101114021) ribonuclease, RNase A family, k6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005615 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005615 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005615 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030098 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030098 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030098 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051791 MISSION® esiRNA esiRNA human RNASE6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005615 Rosetta Predictions human pricing
NM_206815 Rosetta Predictions rat pricing
NM_030098 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339935 predicted 784
2 SASI_Hs01_00147783 predicted 345
3 SASI_Hs01_00147784 predicted 520
4 SASI_Hs01_00147785 predicted 723
5 SASI_Hs01_00147786 predicted 432
6 SASI_Hs01_00147787 predicted 406
7 SASI_Hs01_00147789 predicted 747
8 SASI_Hs02_00339936 predicted 463
9 SASI_Hs01_00147790 predicted 522
10 SASI_Hs02_00339937 predicted 767
11 SASI_Hs01_00147782 predicted 296
12 SASI_Hs01_00147788 predicted 781
13 SASI_Hs01_00147791 predicted 411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206815 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066067 predicted 197
2 SASI_Rn01_00066068 predicted 202
3 SASI_Rn01_00066069 predicted 204
4 SASI_Rn01_00066070 predicted 195
5 SASI_Rn01_00066071 predicted 240
6 SASI_Rn01_00066072 predicted 234
7 SASI_Rn01_00066073 predicted 237
8 SASI_Rn01_00066074 predicted 239
9 SASI_Rn01_00066075 predicted 229
10 SASI_Rn01_00066076 predicted 193
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030098 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035358 predicted 431
2 SASI_Mm01_00035360 predicted 380
3 SASI_Mm01_00035361 predicted 352
4 SASI_Mm01_00035362 predicted 306
5 SASI_Mm01_00035363 predicted 435
6 SASI_Mm01_00035364 predicted 339
7 SASI_Mm02_00336492 predicted 206
8 SASI_Mm01_00035365 predicted 402
9 SASI_Mm01_00035366 predicted 413
10 SASI_Mm01_00035367 predicted 257
11 SASI_Mm01_00035359 predicted 285
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005615
RNASE6 MISSION shRNA Bacterial Glycerol Stock
ribonuclease, RNase A family, k6
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005615.2-651s1c1
Sequence:CCGGGCCCAGTACAAATTCTTCATTCTCGAGAATGAAGAATTTGTACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005615.2-389s1c1
Sequence:CCGGCTGGTTTGAAATTCAGCATATCTCGAGATATGCTGAATTTCAAACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005615.2-720s1c1
Sequence:CCGGCCTGTACACTTAGATAGTATTCTCGAGAATACTATCTAAGTGTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005615.2-705s1c1
Sequence:CCGGCCCTACAAGTTGGTTCCTGTACTCGAGTACAGGAACCAACTTGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005615.2-605s1c1
Sequence:CCGGCAGACTCACTTCAGGAAAGTACTCGAGTACTTTCCTGAAGTGAGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005615.4-441s21c1
Sequence:CCGGATGAGTGGCATCAACAATTATCTCGAGATAATTGTTGATGCCACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005615.4-774s21c1
Sequence:CCGGACATAGCTTCTGTTACAATTGCTCGAGCAATTGTAACAGAAGCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005615
RNASE6 MISSION shRNA shRNA Plasmid DNA
ribonuclease, RNase A family, k6
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005615.2-651s1c1
Sequence:CCGGGCCCAGTACAAATTCTTCATTCTCGAGAATGAAGAATTTGTACTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005615.2-389s1c1
Sequence:CCGGCTGGTTTGAAATTCAGCATATCTCGAGATATGCTGAATTTCAAACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005615.2-720s1c1
Sequence:CCGGCCTGTACACTTAGATAGTATTCTCGAGAATACTATCTAAGTGTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005615.2-705s1c1
Sequence:CCGGCCCTACAAGTTGGTTCCTGTACTCGAGTACAGGAACCAACTTGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005615.2-605s1c1
Sequence:CCGGCAGACTCACTTCAGGAAAGTACTCGAGTACTTTCCTGAAGTGAGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005615.4-441s21c1
Sequence:CCGGATGAGTGGCATCAACAATTATCTCGAGATAATTGTTGATGCCACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005615.4-774s21c1
Sequence:CCGGACATAGCTTCTGTTACAATTGCTCGAGCAATTGTAACAGAAGCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005615
RNASE6 MISSION shRNA Lentiviral Transduction Particles
ribonuclease, RNase A family, k6
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005615.2-651s1c1
Sequence:CCGGGCCCAGTACAAATTCTTCATTCTCGAGAATGAAGAATTTGTACTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005615.2-389s1c1
Sequence:CCGGCTGGTTTGAAATTCAGCATATCTCGAGATATGCTGAATTTCAAACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005615.2-720s1c1
Sequence:CCGGCCTGTACACTTAGATAGTATTCTCGAGAATACTATCTAAGTGTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005615.2-705s1c1
Sequence:CCGGCCCTACAAGTTGGTTCCTGTACTCGAGTACAGGAACCAACTTGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005615.2-605s1c1
Sequence:CCGGCAGACTCACTTCAGGAAAGTACTCGAGTACTTTCCTGAAGTGAGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005615.4-441s21c1
Sequence:CCGGATGAGTGGCATCAACAATTATCTCGAGATAATTGTTGATGCCACTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005615.4-774s21c1
Sequence:CCGGACATAGCTTCTGTTACAATTGCTCGAGCAATTGTAACAGAAGCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030098
RNASE6 MISSION shRNA Bacterial Glycerol Stock
ribonuclease, RNase A family, k6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030098.1-516s1c1
Sequence:CCGGCCTGTACACTTAGATAAGATTCTCGAGAATCTTATCTAAGTGTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030098.1-259s1c1
Sequence:CCGGCCCAACACTGTAAACAGATAACTCGAGTTATCTGTTTACAGTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030098.1-329s1c1
Sequence:CCGGGCACAATATCACCTGCAAGAACTCGAGTTCTTGCAGGTGATATTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030098.1-433s1c1
Sequence:CCGGGCTATAGTAGTGATAAGCAATCTCGAGATTGCTTATCACTACTATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030098.1-418s1c1
Sequence:CCGGCCTATCCTAACTGCCGCTATACTCGAGTATAGCGGCAGTTAGGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030098
RNASE6 MISSION shRNA shRNA Plasmid DNA
ribonuclease, RNase A family, k6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030098.1-516s1c1
Sequence:CCGGCCTGTACACTTAGATAAGATTCTCGAGAATCTTATCTAAGTGTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030098.1-259s1c1
Sequence:CCGGCCCAACACTGTAAACAGATAACTCGAGTTATCTGTTTACAGTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030098.1-329s1c1
Sequence:CCGGGCACAATATCACCTGCAAGAACTCGAGTTCTTGCAGGTGATATTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030098.1-433s1c1
Sequence:CCGGGCTATAGTAGTGATAAGCAATCTCGAGATTGCTTATCACTACTATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030098.1-418s1c1
Sequence:CCGGCCTATCCTAACTGCCGCTATACTCGAGTATAGCGGCAGTTAGGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030098
RNASE6 MISSION shRNA Lentiviral Transduction Particles
ribonuclease, RNase A family, k6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030098.1-516s1c1
Sequence:CCGGCCTGTACACTTAGATAAGATTCTCGAGAATCTTATCTAAGTGTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030098.1-259s1c1
Sequence:CCGGCCCAACACTGTAAACAGATAACTCGAGTTATCTGTTTACAGTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030098.1-329s1c1
Sequence:CCGGGCACAATATCACCTGCAAGAACTCGAGTTCTTGCAGGTGATATTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030098.1-433s1c1
Sequence:CCGGGCTATAGTAGTGATAAGCAATCTCGAGATTGCTTATCACTACTATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030098.1-418s1c1
Sequence:CCGGCCTATCCTAACTGCCGCTATACTCGAGTATAGCGGCAGTTAGGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)