EMAIL THIS PAGE TO A FRIEND

RNASE8

ribonuclease, RNase A family, 8

15 Gene Product Result for
UniProtKB ID: Q8TDE3, B2RPP6, B2RPP7
Gene ID:
dog(100688316) ribonuclease, RNase A family, 8
domestic cat(101092943) ribonuclease, RNase A family, 8
cow(100300237) ribonuclease, RNase A family, 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138331 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138331 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138331 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138331 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138331 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028026 predicted 231
2 SASI_Hs01_00028027 predicted 223
3 SASI_Hs01_00028028 predicted 154
4 SASI_Hs01_00028029 predicted 363
5 SASI_Hs01_00028030 predicted 151
6 SASI_Hs01_00028031 predicted 346
7 SASI_Hs01_00028032 predicted 369
8 SASI_Hs01_00028033 predicted 262
9 SASI_Hs01_00028034 predicted 429
10 SASI_Hs01_00028035 predicted 76
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138331
RNASE8 MISSION shRNA Bacterial Glycerol Stock
ribonuclease, RNase A family, 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138331.1-253s1c1
Sequence:CCGGCCCAACATAGCCTGCAAGAATCTCGAGATTCTTGCAGGCTATGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138331.1-153s1c1
Sequence:CCGGCTCAGCCATGAGCATCATCAACTCGAGTTGATGATGCTCATGGCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138331.1-159s1c1
Sequence:CCGGCATGAGCATCATCAATAAGTACTCGAGTACTTATTGATGATGCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138331.1-85s1c1
Sequence:CCGGCCCAAGGACATGACATCATCTCTCGAGAGATGATGTCATGTCCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138331.1-174s21c1
Sequence:CCGGTAAGTACACAGAACGGTGCAACTCGAGTTGCACCGTTCTGTGTACTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138331.1-59s21c1
Sequence:CCGGTGGCAGAGGTCCTAGTCAGAGCTCGAGCTCTGACTAGGACCTCTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138331.1-222s21c1
Sequence:CCGGCTTCTCCAGTGTGGCCATCACCTCGAGGTGATGGCCACACTGGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138331.1-262s21c1
Sequence:CCGGGCCTGCAAGAATAGCTGTAAACTCGAGTTTACAGCTATTCTTGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138331
RNASE8 MISSION shRNA shRNA Plasmid DNA
ribonuclease, RNase A family, 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138331.1-253s1c1
Sequence:CCGGCCCAACATAGCCTGCAAGAATCTCGAGATTCTTGCAGGCTATGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138331.1-153s1c1
Sequence:CCGGCTCAGCCATGAGCATCATCAACTCGAGTTGATGATGCTCATGGCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138331.1-159s1c1
Sequence:CCGGCATGAGCATCATCAATAAGTACTCGAGTACTTATTGATGATGCTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138331.1-85s1c1
Sequence:CCGGCCCAAGGACATGACATCATCTCTCGAGAGATGATGTCATGTCCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138331.1-174s21c1
Sequence:CCGGTAAGTACACAGAACGGTGCAACTCGAGTTGCACCGTTCTGTGTACTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138331.1-59s21c1
Sequence:CCGGTGGCAGAGGTCCTAGTCAGAGCTCGAGCTCTGACTAGGACCTCTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138331.1-222s21c1
Sequence:CCGGCTTCTCCAGTGTGGCCATCACCTCGAGGTGATGGCCACACTGGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138331.1-262s21c1
Sequence:CCGGGCCTGCAAGAATAGCTGTAAACTCGAGTTTACAGCTATTCTTGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138331
RNASE8 MISSION shRNA Lentiviral Transduction Particles
ribonuclease, RNase A family, 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138331.1-253s1c1
Sequence:CCGGCCCAACATAGCCTGCAAGAATCTCGAGATTCTTGCAGGCTATGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138331.1-153s1c1
Sequence:CCGGCTCAGCCATGAGCATCATCAACTCGAGTTGATGATGCTCATGGCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138331.1-159s1c1
Sequence:CCGGCATGAGCATCATCAATAAGTACTCGAGTACTTATTGATGATGCTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138331.1-85s1c1
Sequence:CCGGCCCAAGGACATGACATCATCTCTCGAGAGATGATGTCATGTCCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138331.1-174s21c1
Sequence:CCGGTAAGTACACAGAACGGTGCAACTCGAGTTGCACCGTTCTGTGTACTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138331.1-59s21c1
Sequence:CCGGTGGCAGAGGTCCTAGTCAGAGCTCGAGCTCTGACTAGGACCTCTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138331.1-222s21c1
Sequence:CCGGCTTCTCCAGTGTGGCCATCACCTCGAGGTGATGGCCACACTGGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138331.1-262s21c1
Sequence:CCGGGCCTGCAAGAATAGCTGTAAACTCGAGTTTACAGCTATTCTTGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)