EMAIL THIS PAGE TO A FRIEND

RNASEH2C

ribonuclease H2, subunit C

89 Gene Product Result for
Synonyms: AGS3 AYP1
UniProtKB ID: Q8TDP1, Q9H7F5
Gene ID:
Human(84153) Summary: This gene encodes a ribonuclease H subunit that can cleave ribonucleotides from RNA:DNA duplexes. Mutations in this gene cause Aicardi-Goutieres syndrome-3, a disease that causes severe neurologic dysfunction. A pseudogene for this gene has been identified on chromosome Y, near the sex determining region Y (SRY) gene. [provided by RefSeq, Jul 2008]
Mouse(68209) ribonuclease H2, subunit C
Rat(100361939) ribonuclease H2, subunit C
domestic cat(101100003) ribonuclease H2, subunit C
dog(610886) ribonuclease H2, subunit C
cow(505618) ribonuclease H2, subunit C
sheep(101109926) ribonuclease H2, subunit C
domestic guinea pig(100732011) ribonuclease H2, subunit C
naked mole-rat(101716160) ribonuclease H2, subunit C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032193 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032193 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032193 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026616 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026616 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026616 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032193 Rosetta Predictions human pricing
NM_026616 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032193 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084039 predicted 626
2 SASI_Hs02_00359476 predicted 770
3 SASI_Hs02_00359477 predicted 845
4 SASI_Hs01_00084041 predicted 213
5 SASI_Hs01_00084042 predicted 539
6 SASI_Hs02_00359478 predicted 701
7 SASI_Hs02_00359479 predicted 722
8 SASI_Hs02_00359480 predicted 419
9 SASI_Hs02_00359481 predicted 691
10 SASI_Hs01_00084045 predicted 227
11 SASI_Hs01_00084040 predicted 409
12 SASI_Hs01_00084043 predicted 644
13 SASI_Hs01_00084044 predicted 518
14 SASI_Hs01_00084046 predicted 353
15 SASI_Hs01_00084047 predicted 484
16 SASI_Hs01_00084048 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026616 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064124 predicted 404
2 SASI_Mm01_00064125 predicted 258
3 SASI_Mm01_00064126 predicted 373
4 SASI_Mm01_00064127 predicted 202
5 SASI_Mm01_00064128 predicted 399
6 SASI_Mm01_00064129 predicted 201
7 SASI_Mm01_00064130 predicted 251
8 SASI_Mm01_00064131 predicted 256
9 SASI_Mm01_00064132 predicted 269
10 SASI_Mm01_00064133 predicted 380
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032193
RNASEH2C MISSION shRNA Bacterial Glycerol Stock
ribonuclease H2, subunit C
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032193.3-843s21c1
Sequence:CCGGTTGCATGGCTCTGGCATATAGCTCGAGCTATATGCCAGAGCCATGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032193.3-350s21c1
Sequence:CCGGAGGGACTCGAAGTGTCGTTTCCTCGAGGAAACGACACTTCGAGTCCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032193.2-429s1c1
Sequence:CCGGGATGGTGACAGAAGAGAAGAACTCGAGTTCTTCTCTTCTGTCACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032193.2-422s1c1
Sequence:CCGGGATACGTGATGGTGACAGAAGCTCGAGCTTCTGTCACCATCACGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032193.3-966s21c1
Sequence:CCGGCAATCACCAGCCCTCTGTACACTCGAGTGTACAGAGGGCTGGTGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032193.3-523s21c1
Sequence:CCGGGACTTCGACCGCTTCATTGGACTCGAGTCCAATGAAGCGGTCGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165346    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032193.2-715s1c1
Sequence:CCGGGCAGTAAACCAGCTCTTTGGACTCGAGTCCAAAGAGCTGGTTTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032193.2-726s1c1
Sequence:CCGGGCTCTTTGGAACCGATTCCATCTCGAGATGGAATCGGTTCCAAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032193.2-433s1c1
Sequence:CCGGGTGACAGAAGAGAAGAAGGTGCTCGAGCACCTTCTTCTCTTCTGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032193
RNASEH2C MISSION shRNA shRNA Plasmid DNA
ribonuclease H2, subunit C
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032193.3-843s21c1
Sequence:CCGGTTGCATGGCTCTGGCATATAGCTCGAGCTATATGCCAGAGCCATGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032193.3-350s21c1
Sequence:CCGGAGGGACTCGAAGTGTCGTTTCCTCGAGGAAACGACACTTCGAGTCCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032193.2-429s1c1
Sequence:CCGGGATGGTGACAGAAGAGAAGAACTCGAGTTCTTCTCTTCTGTCACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032193.2-422s1c1
Sequence:CCGGGATACGTGATGGTGACAGAAGCTCGAGCTTCTGTCACCATCACGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032193.3-966s21c1
Sequence:CCGGCAATCACCAGCCCTCTGTACACTCGAGTGTACAGAGGGCTGGTGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032193.3-523s21c1
Sequence:CCGGGACTTCGACCGCTTCATTGGACTCGAGTCCAATGAAGCGGTCGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165346    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032193.2-715s1c1
Sequence:CCGGGCAGTAAACCAGCTCTTTGGACTCGAGTCCAAAGAGCTGGTTTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032193.2-726s1c1
Sequence:CCGGGCTCTTTGGAACCGATTCCATCTCGAGATGGAATCGGTTCCAAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032193.2-433s1c1
Sequence:CCGGGTGACAGAAGAGAAGAAGGTGCTCGAGCACCTTCTTCTCTTCTGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032193
RNASEH2C MISSION shRNA Lentiviral Transduction Particles
ribonuclease H2, subunit C
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032193.3-843s21c1
Sequence:CCGGTTGCATGGCTCTGGCATATAGCTCGAGCTATATGCCAGAGCCATGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032193.3-350s21c1
Sequence:CCGGAGGGACTCGAAGTGTCGTTTCCTCGAGGAAACGACACTTCGAGTCCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032193.2-429s1c1
Sequence:CCGGGATGGTGACAGAAGAGAAGAACTCGAGTTCTTCTCTTCTGTCACCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032193.2-422s1c1
Sequence:CCGGGATACGTGATGGTGACAGAAGCTCGAGCTTCTGTCACCATCACGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032193.3-966s21c1
Sequence:CCGGCAATCACCAGCCCTCTGTACACTCGAGTGTACAGAGGGCTGGTGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032193.3-523s21c1
Sequence:CCGGGACTTCGACCGCTTCATTGGACTCGAGTCCAATGAAGCGGTCGAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165346    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032193.2-715s1c1
Sequence:CCGGGCAGTAAACCAGCTCTTTGGACTCGAGTCCAAAGAGCTGGTTTACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032193.2-726s1c1
Sequence:CCGGGCTCTTTGGAACCGATTCCATCTCGAGATGGAATCGGTTCCAAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032193.2-433s1c1
Sequence:CCGGGTGACAGAAGAGAAGAAGGTGCTCGAGCACCTTCTTCTCTTCTGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026616
VALIDATED
RNASEH2C MISSION shRNA Bacterial Glycerol Stock
ribonuclease H2, subunit C
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000189847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026616.1-405s1c1
Sequence:CCGGGCTTCAGCCATTTCACCTTGTCTCGAGACAAGGTGAAATGGCTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026616.1-447s1c1
Sequence:CCGGGTCCAGATGCCAAAGTGCATACTCGAGTATGCACTTTGGCATCTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026616.2-62s21c1
Sequence:CCGGACGGGAAACAGCGTATTCACCCTCGAGGGTGAATACGCTGTTTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026616.2-162s21c1
Sequence:CCGGCCCGGTAGATCGCTTCTTCACCTCGAGGTGAAGAAGCGATCTACCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026616.2-414s21c1
Sequence:CCGGCAGCTTCAGCCATTTCACCTTCTCGAGAAGGTGAAATGGCTGAAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026616.2-459s21c1
Sequence:CCGGTCCAGATGCCAAAGTGCATAGCTCGAGCTATGCACTTTGGCATCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026616.2-315s21c1
Sequence:CCGGGATAGGGAAACTGAACTTCTCCTCGAGGAGAAGTTCAGTTTCCCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026616.1-304s1c1
Sequence:CCGGGATAGGGAAACTGAACTTCTCCTCGAGGAGAAGTTCAGTTTCCCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026616.1-403s1c1
Sequence:CCGGCAGCTTCAGCCATTTCACCTTCTCGAGAAGGTGAAATGGCTGAAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026616
VALIDATED
RNASEH2C MISSION shRNA shRNA Plasmid DNA
ribonuclease H2, subunit C
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000189847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026616.1-405s1c1
Sequence:CCGGGCTTCAGCCATTTCACCTTGTCTCGAGACAAGGTGAAATGGCTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026616.1-447s1c1
Sequence:CCGGGTCCAGATGCCAAAGTGCATACTCGAGTATGCACTTTGGCATCTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026616.2-62s21c1
Sequence:CCGGACGGGAAACAGCGTATTCACCCTCGAGGGTGAATACGCTGTTTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026616.2-162s21c1
Sequence:CCGGCCCGGTAGATCGCTTCTTCACCTCGAGGTGAAGAAGCGATCTACCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026616.2-414s21c1
Sequence:CCGGCAGCTTCAGCCATTTCACCTTCTCGAGAAGGTGAAATGGCTGAAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026616.2-459s21c1
Sequence:CCGGTCCAGATGCCAAAGTGCATAGCTCGAGCTATGCACTTTGGCATCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026616.2-315s21c1
Sequence:CCGGGATAGGGAAACTGAACTTCTCCTCGAGGAGAAGTTCAGTTTCCCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026616.1-304s1c1
Sequence:CCGGGATAGGGAAACTGAACTTCTCCTCGAGGAGAAGTTCAGTTTCCCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026616.1-403s1c1
Sequence:CCGGCAGCTTCAGCCATTTCACCTTCTCGAGAAGGTGAAATGGCTGAAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026616
VALIDATED
RNASEH2C MISSION shRNA Lentiviral Transduction Particles
ribonuclease H2, subunit C
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000189847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026616.1-405s1c1
Sequence:CCGGGCTTCAGCCATTTCACCTTGTCTCGAGACAAGGTGAAATGGCTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026616.1-447s1c1
Sequence:CCGGGTCCAGATGCCAAAGTGCATACTCGAGTATGCACTTTGGCATCTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026616.2-62s21c1
Sequence:CCGGACGGGAAACAGCGTATTCACCCTCGAGGGTGAATACGCTGTTTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026616.2-162s21c1
Sequence:CCGGCCCGGTAGATCGCTTCTTCACCTCGAGGTGAAGAAGCGATCTACCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026616.2-414s21c1
Sequence:CCGGCAGCTTCAGCCATTTCACCTTCTCGAGAAGGTGAAATGGCTGAAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026616.2-459s21c1
Sequence:CCGGTCCAGATGCCAAAGTGCATAGCTCGAGCTATGCACTTTGGCATCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026616.2-315s21c1
Sequence:CCGGGATAGGGAAACTGAACTTCTCCTCGAGGAGAAGTTCAGTTTCCCTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026616.1-304s1c1
Sequence:CCGGGATAGGGAAACTGAACTTCTCCTCGAGGAGAAGTTCAGTTTCCCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026616.1-403s1c1
Sequence:CCGGCAGCTTCAGCCATTTCACCTTCTCGAGAAGGTGAAATGGCTGAAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)