EMAIL THIS PAGE TO A FRIEND

RNASET2

ribonuclease T2

40 Gene Product Result for
Synonyms: RNASE6PL bA514O12.3
Gene ID:
Human(8635) Summary: This ribonuclease gene is a novel member of the Rh/T2/S-glycoprotein class of extracellular ribonucleases. It is a single copy gene that maps to 6q27, a region associated with human malignancies and chromosomal rearrangement. [provided by RefSeq, Jul 2008]
Rat(292306) ribonuclease T2
Zebrafish(791890) ribonuclease T2
chicken(421569) ribonuclease T2
dog(612451) ribonuclease T2
domestic cat(101080386) ribonuclease T2
naked mole-rat(101708129) ribonuclease T2
cow(508245) ribonuclease T2
sheep(101114785) ribonuclease T2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003730 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003730 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003730 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU094731 MISSION® esiRNA esiRNA human RNASET2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003730 Rosetta Predictions human pricing
NM_001106210 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003730 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079529 predicted 688
2 SASI_Hs01_00079530 predicted 836
3 SASI_Hs01_00079532 predicted 534
4 SASI_Hs01_00079534 predicted 627
5 SASI_Hs01_00079535 predicted 981
6 SASI_Hs01_00079536 predicted 579
7 SASI_Hs02_00336178 predicted 989
8 SASI_Hs01_00079537 predicted 881
9 SASI_Hs01_00079538 predicted 921
10 SASI_Hs02_00336179 predicted 599
11 SASI_Hs01_00079531 predicted 479
12 SASI_Hs01_00079533 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106210 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216718 predicted 321
2 SASI_Rn02_00216719 predicted 606
3 SASI_Rn02_00216720 predicted 514
4 SASI_Rn02_00216721 predicted 562
5 SASI_Rn02_00216722 predicted 668
6 SASI_Rn02_00216723 predicted 240
7 SASI_Rn02_00216724 predicted 688
8 SASI_Rn02_00216725 predicted 416
9 SASI_Rn02_00216726 predicted 530
10 SASI_Rn02_00216727 predicted 677
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003730
VALIDATED
RNASET2 MISSION shRNA Bacterial Glycerol Stock
ribonuclease T2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003730.3-537s1c1
Sequence:CCGGCCTGAGACAGTATGCGAGAAACTCGAGTTTCTCGCATACTGTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003730.3-924s1c1
Sequence:CCGGGCCAGAGTATATGGAGTGATACTCGAGTATCACTCCATATACTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003730.3-579s1c1
Sequence:CCGGCCTCCGGATTACTGGACAATACTCGAGTATTGTCCAGTAATCCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003730.3-699s1c1
Sequence:CCGGCCTGACGTAATTCACTCGTTTCTCGAGAAACGAGTGAATTACGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003730.3-975s1c1
Sequence:CCGGGATGAGGAAGTACAGACAATTCTCGAGAATTGTCTGTACTTCCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003730.4-537s21c1
Sequence:CCGGCCTGAGACAGTATGCGAGAAACTCGAGTTTCTCGCATACTGTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003730.4-636s21c1
Sequence:CCGGAGATCGTGGCCCTTCAATTTACTCGAGTAAATTGAAGGGCCACGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003730.4-600s21c1
Sequence:CCGGCATGGACTATGGCCCGATAAACTCGAGTTTATCGGGCCATAGTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003730.4-690s21c1
Sequence:CCGGGCATACTGGCCTGACGTAATTCTCGAGAATTACGTCAGGCCAGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003730.4-975s21c1
Sequence:CCGGGATGAGGAAGTACAGACAATTCTCGAGAATTGTCTGTACTTCCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003730
VALIDATED
RNASET2 MISSION shRNA shRNA Plasmid DNA
ribonuclease T2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003730.3-537s1c1
Sequence:CCGGCCTGAGACAGTATGCGAGAAACTCGAGTTTCTCGCATACTGTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003730.3-924s1c1
Sequence:CCGGGCCAGAGTATATGGAGTGATACTCGAGTATCACTCCATATACTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003730.3-579s1c1
Sequence:CCGGCCTCCGGATTACTGGACAATACTCGAGTATTGTCCAGTAATCCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003730.3-699s1c1
Sequence:CCGGCCTGACGTAATTCACTCGTTTCTCGAGAAACGAGTGAATTACGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003730.3-975s1c1
Sequence:CCGGGATGAGGAAGTACAGACAATTCTCGAGAATTGTCTGTACTTCCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003730.4-537s21c1
Sequence:CCGGCCTGAGACAGTATGCGAGAAACTCGAGTTTCTCGCATACTGTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003730.4-636s21c1
Sequence:CCGGAGATCGTGGCCCTTCAATTTACTCGAGTAAATTGAAGGGCCACGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003730.4-600s21c1
Sequence:CCGGCATGGACTATGGCCCGATAAACTCGAGTTTATCGGGCCATAGTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003730.4-690s21c1
Sequence:CCGGGCATACTGGCCTGACGTAATTCTCGAGAATTACGTCAGGCCAGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003730.4-975s21c1
Sequence:CCGGGATGAGGAAGTACAGACAATTCTCGAGAATTGTCTGTACTTCCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003730
VALIDATED
RNASET2 MISSION shRNA Lentiviral Transduction Particles
ribonuclease T2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003730.3-537s1c1
Sequence:CCGGCCTGAGACAGTATGCGAGAAACTCGAGTTTCTCGCATACTGTCTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003730.3-924s1c1
Sequence:CCGGGCCAGAGTATATGGAGTGATACTCGAGTATCACTCCATATACTCTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003730.3-579s1c1
Sequence:CCGGCCTCCGGATTACTGGACAATACTCGAGTATTGTCCAGTAATCCGGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003730.3-699s1c1
Sequence:CCGGCCTGACGTAATTCACTCGTTTCTCGAGAAACGAGTGAATTACGTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003730.3-975s1c1
Sequence:CCGGGATGAGGAAGTACAGACAATTCTCGAGAATTGTCTGTACTTCCTCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003730.4-537s21c1
Sequence:CCGGCCTGAGACAGTATGCGAGAAACTCGAGTTTCTCGCATACTGTCTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003730.4-636s21c1
Sequence:CCGGAGATCGTGGCCCTTCAATTTACTCGAGTAAATTGAAGGGCCACGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003730.4-600s21c1
Sequence:CCGGCATGGACTATGGCCCGATAAACTCGAGTTTATCGGGCCATAGTCCATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003730.4-690s21c1
Sequence:CCGGGCATACTGGCCTGACGTAATTCTCGAGAATTACGTCAGGCCAGTATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003730.4-975s21c1
Sequence:CCGGGATGAGGAAGTACAGACAATTCTCGAGAATTGTCTGTACTTCCTCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)