EMAIL THIS PAGE TO A FRIEND

RND1

Rho family GTPase 1

141 Gene Product Result for
Synonyms: ARHS RHO6 RHOS
UniProtKB ID: Q92730, A8K9P7
Gene ID:
Human(27289) Summary: Members of the Rho GTPase family, such as RND1, regulate the organization of the actin cytoskeleton in response to extracellular growth factors (Nobes et al., 1998 [PubMed 9531558]
Mouse(223881) Rho family GTPase 1
Rat(362993) Rho family GTPase 1
Zebrafish(405780) Rho family GTPase 1
domestic cat(101092619) Rho family GTPase 1
dog(477623) Rho family GTPase 1
cow(508869) Rho family GTPase 1
sheep(101104473) Rho family GTPase 1
domestic guinea pig(100729748) Rho family GTPase 1
naked mole-rat(101726102) Rho family GTPase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014470 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014470 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014470 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172612 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172612 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172612 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014470 Rosetta Predictions human pricing
NM_001013222 Rosetta Predictions rat pricing
NM_172612 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014470 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031009 predicted 391
2 SASI_Hs01_00031011 predicted 551
3 SASI_Hs01_00031014 predicted 1275
4 SASI_Hs01_00031015 predicted 787
5 SASI_Hs02_00345699 predicted 742
6 SASI_Hs02_00345700 predicted 630
7 SASI_Hs01_00031017 predicted 306
8 SASI_Hs01_00031018 predicted 350
9 SASI_Hs02_00345701 predicted 481
10 SASI_Hs02_00345702 predicted 595
11 SASI_Hs01_00031010 predicted 653
12 SASI_Hs01_00031012 predicted 286
13 SASI_Hs01_00031013 predicted 275
14 SASI_Hs01_00031016 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013222 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039042 predicted 588
2 SASI_Rn01_00039043 predicted 1084
3 SASI_Rn01_00039044 predicted 729
4 SASI_Rn01_00039045 predicted 1172
5 SASI_Rn01_00039046 predicted 272
6 SASI_Rn01_00039047 predicted 890
7 SASI_Rn01_00039048 predicted 349
8 SASI_Rn01_00039049 predicted 634
9 SASI_Rn01_00039050 predicted 277
10 SASI_Rn01_00039051 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172612 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344309 predicted 431
2 SASI_Mm02_00344310 predicted 367
3 SASI_Mm02_00344311 predicted 212
4 SASI_Mm02_00344312 predicted 790
5 SASI_Mm02_00344313 predicted 621
6 SASI_Mm02_00344314 predicted 753
7 SASI_Mm02_00344315 predicted 478
8 SASI_Mm02_00344316 predicted 484
9 SASI_Mm02_00344317 predicted 283
10 SASI_Mm02_00344318 predicted 753
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014470
RND1 MISSION shRNA Bacterial Glycerol Stock
Rho family GTPase 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000047433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014470.2-285s1c1
Sequence:CCGGTGGAGCTTAGTCTCTGGGATACTCGAGTATCCCAGAGACTAAGCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014470.2-317s1c1
Sequence:CCGGCCCTACTACGATAATGTCCGTCTCGAGACGGACATTATCGTAGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014470.2-540s1c1
Sequence:CCGGCCATCTCCTATGAGCAGGGTTCTCGAGAACCCTGCTCATAGGAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014470.2-741s1c1
Sequence:CCGGGCTCTGAACTCATCTCTTCTACTCGAGTAGAAGAGATGAGTTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014470
RND1 MISSION shRNA shRNA Plasmid DNA
Rho family GTPase 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000047433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014470.2-285s1c1
Sequence:CCGGTGGAGCTTAGTCTCTGGGATACTCGAGTATCCCAGAGACTAAGCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014470.2-317s1c1
Sequence:CCGGCCCTACTACGATAATGTCCGTCTCGAGACGGACATTATCGTAGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014470.2-540s1c1
Sequence:CCGGCCATCTCCTATGAGCAGGGTTCTCGAGAACCCTGCTCATAGGAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014470.2-741s1c1
Sequence:CCGGGCTCTGAACTCATCTCTTCTACTCGAGTAGAAGAGATGAGTTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014470
RND1 MISSION shRNA Lentiviral Transduction Particles
Rho family GTPase 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000047433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014470.2-285s1c1
Sequence:CCGGTGGAGCTTAGTCTCTGGGATACTCGAGTATCCCAGAGACTAAGCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014470.2-317s1c1
Sequence:CCGGCCCTACTACGATAATGTCCGTCTCGAGACGGACATTATCGTAGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014470.2-540s1c1
Sequence:CCGGCCATCTCCTATGAGCAGGGTTCTCGAGAACCCTGCTCATAGGAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014470.2-741s1c1
Sequence:CCGGGCTCTGAACTCATCTCTTCTACTCGAGTAGAAGAGATGAGTTCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172612
VALIDATED
RND1 MISSION shRNA Bacterial Glycerol Stock
Rho family GTPase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172612.1-1838s1c1
Sequence:CCGGGCTTCCTAAGTGCTGGGATTACTCGAGTAATCCCAGCACTTAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172612.1-766s1c1
Sequence:CCGGCAACTACATTCAAGAAGGAAACTCGAGTTTCCTTCTTGAATGTAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172612.1-630s1c1
Sequence:CCGGGAGACAAGCATCCACAGCATTCTCGAGAATGCTGTGGATGCTTGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172612.1-758s1c1
Sequence:CCGGACTCATCTCAACTACATTCAACTCGAGTTGAATGTAGTTGAGATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172612.1-484s1c1
Sequence:CCGGGCTGCAAGACAGATCTTCGAACTCGAGTTCGAAGATCTGTCTTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172612
VALIDATED
RND1 MISSION shRNA shRNA Plasmid DNA
Rho family GTPase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172612.1-1838s1c1
Sequence:CCGGGCTTCCTAAGTGCTGGGATTACTCGAGTAATCCCAGCACTTAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172612.1-766s1c1
Sequence:CCGGCAACTACATTCAAGAAGGAAACTCGAGTTTCCTTCTTGAATGTAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172612.1-630s1c1
Sequence:CCGGGAGACAAGCATCCACAGCATTCTCGAGAATGCTGTGGATGCTTGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172612.1-758s1c1
Sequence:CCGGACTCATCTCAACTACATTCAACTCGAGTTGAATGTAGTTGAGATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172612.1-484s1c1
Sequence:CCGGGCTGCAAGACAGATCTTCGAACTCGAGTTCGAAGATCTGTCTTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172612
VALIDATED
RND1 MISSION shRNA Lentiviral Transduction Particles
Rho family GTPase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172612.1-1838s1c1
Sequence:CCGGGCTTCCTAAGTGCTGGGATTACTCGAGTAATCCCAGCACTTAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172612.1-766s1c1
Sequence:CCGGCAACTACATTCAAGAAGGAAACTCGAGTTTCCTTCTTGAATGTAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172612.1-630s1c1
Sequence:CCGGGAGACAAGCATCCACAGCATTCTCGAGAATGCTGTGGATGCTTGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172612.1-758s1c1
Sequence:CCGGACTCATCTCAACTACATTCAACTCGAGTTGAATGTAGTTGAGATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172612.1-484s1c1
Sequence:CCGGGCTGCAAGACAGATCTTCGAACTCGAGTTCGAAGATCTGTCTTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)