EMAIL THIS PAGE TO A FRIEND

RNF103

ring finger protein 103

134 Gene Product Result for
Synonyms: HKF-1 KF-1 KF1 ZFP-103 ZFP103
UniProtKB ID: O00237, A6NFV6, Q53SU6, Q8IVB9
Gene ID:
Human(7844) Summary: The protein encoded by this gene contains a RING-H2 finger, a motif known to be involved in protein-protein and protein-DNA interactions. This gene is highly expressed in normal cerebellum, but not in the cerebral cortex. The expression of the rat counterpart in the frontal cortex and hippocampus was shown to be induced by elctroconvulsive treatment (ECT) as well as chronic antidepressant treatment, suggesting that this gene may be a molecular target for ECT and antidepressants. The protein is a ubiquitin ligase that functions in the endoplasmic reticulum-associated degradation pathway. Alternative splicing of this gene results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream CHMP3 (charged multivesicular body protein 3) gene. [provided by RefSeq, Oct 2011]
Mouse(22644) ring finger protein 103
Rat(84508) ring finger protein 103
cow(511639) ring finger protein 103
sheep(101107007) ring finger protein 103
naked mole-rat(101722511) ring finger protein 103
Zebrafish(447861) ring finger protein 103
chicken(422919) ring finger protein 103
domestic cat(101094260) ring finger protein 103
Horse(100052907) ring finger protein 103
dog(475761) ring finger protein 103
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009543 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009543 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009543 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005667 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005667 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005667 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU018161 MISSION® esiRNA esiRNA targeting human RNF103 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005667 Rosetta Predictions human pricing
NM_053438 Rosetta Predictions rat pricing
XM_001062640 Rosetta Predictions rat pricing
XM_579558 Rosetta Predictions rat pricing
NM_009543 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005667 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162766 predicted 1399
2 SASI_Hs01_00162769 predicted 1979
3 SASI_Hs01_00162770 predicted 2382
4 SASI_Hs02_00340045 predicted 1209
5 SASI_Hs01_00162772 predicted 2240
6 SASI_Hs01_00162773 predicted 2041
7 SASI_Hs02_00340046 predicted 1553
8 SASI_Hs01_00162774 predicted 2497
9 SASI_Hs01_00162775 predicted 2423
10 SASI_Hs02_00340047 predicted 1650
11 SASI_Hs01_00162767 predicted 1421
12 SASI_Hs01_00162768 predicted 1855
13 SASI_Hs01_00162771 predicted 2048
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053438 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037288 predicted 1368
2 SASI_Rn01_00037289 predicted 1188
3 SASI_Rn02_00266012 predicted 1936
4 SASI_Rn01_00037290 predicted 918
5 SASI_Rn01_00037291 predicted 1047
6 SASI_Rn01_00037292 predicted 1011
7 SASI_Rn01_00037293 predicted 1792
8 SASI_Rn01_00037295 predicted 842
9 SASI_Rn01_00037296 predicted 1477
10 SASI_Rn01_00037297 predicted 2105
11 SASI_Rn01_00037294 predicted 1042
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062640 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304089 predicted 2336
2 SASI_Rn02_00304090 predicted 2154
3 SASI_Rn02_00304091 predicted 2904
4 SASI_Rn02_00304092 predicted 1891
5 SASI_Rn02_00304093 predicted 2014
6 SASI_Rn02_00304094 predicted 1974
7 SASI_Rn02_00304095 predicted 2760
8 SASI_Rn02_00304096 predicted 1808
9 SASI_Rn02_00304097 predicted 2447
10 SASI_Rn02_00304098 predicted 3071
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579558 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00163650 predicted 2096
2 SASI_Rn01_00163651 predicted 1925
3 SASI_Rn01_00163652 predicted 1654
4 SASI_Rn01_00163653 predicted 1005
5 SASI_Rn01_00163654 predicted 1772
6 SASI_Rn01_00163655 predicted 1738
7 SASI_Rn01_00163656 predicted 1800
8 SASI_Rn01_00163657 predicted 1043
9 SASI_Rn01_00163658 predicted 1568
10 SASI_Rn01_00163659 predicted 2211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009543 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137882 predicted 2532
2 SASI_Mm01_00137883 predicted 1697
3 SASI_Mm01_00137884 predicted 2778
4 SASI_Mm01_00137885 predicted 1650
5 SASI_Mm01_00137886 predicted 2468
6 SASI_Mm01_00137887 predicted 1788
7 SASI_Mm01_00137888 predicted 2225
8 SASI_Mm02_00316380 predicted 1936
9 SASI_Mm01_00137889 predicted 1453
10 SASI_Mm02_00316381 predicted 1581
11 SASI_Mm01_00137881 predicted 1046
12 SASI_Mm01_00137890 predicted 2690
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009543
VALIDATED
RNF103 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 103
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009543.2-2213s21c1
Sequence:CCGGGACGAAGACCCTGACTTATTCCTCGAGGAATAAGTCAGGGTCTTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009543.2-1821s21c1
Sequence:CCGGAGCGATTTGTGGTTCTCATAACTCGAGTTATGAGAACCACAAATCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009543.2-2928s21c1
Sequence:CCGGTGACAGGAAATACACATTATGCTCGAGCATAATGTGTATTTCCTGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009543.2-2951s21c1
Sequence:CCGGGATGTTGATGACAGAATTTATCTCGAGATAAATTCTGTCATCAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009543.1-2845s1c1
Sequence:CCGGGCCTTGAGTATCTTACAGCTTCTCGAGAAGCTGTAAGATACTCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009543.1-1299s1c1
Sequence:CCGGGCCACAAACAAGTACATCTAACTCGAGTTAGATGTACTTGTTTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009543.1-1718s1c1
Sequence:CCGGGCTCATTACAACCTGAAGTAACTCGAGTTACTTCAGGTTGTAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009543.1-1506s1c1
Sequence:CCGGGCCAGCTTTCTTCTCTGCATTCTCGAGAATGCAGAGAAGAAAGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009543
VALIDATED
RNF103 MISSION shRNA shRNA Plasmid DNA
ring finger protein 103
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009543.2-2213s21c1
Sequence:CCGGGACGAAGACCCTGACTTATTCCTCGAGGAATAAGTCAGGGTCTTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009543.2-1821s21c1
Sequence:CCGGAGCGATTTGTGGTTCTCATAACTCGAGTTATGAGAACCACAAATCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009543.2-2928s21c1
Sequence:CCGGTGACAGGAAATACACATTATGCTCGAGCATAATGTGTATTTCCTGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009543.2-2951s21c1
Sequence:CCGGGATGTTGATGACAGAATTTATCTCGAGATAAATTCTGTCATCAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009543.1-2845s1c1
Sequence:CCGGGCCTTGAGTATCTTACAGCTTCTCGAGAAGCTGTAAGATACTCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009543.1-1299s1c1
Sequence:CCGGGCCACAAACAAGTACATCTAACTCGAGTTAGATGTACTTGTTTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009543.1-1718s1c1
Sequence:CCGGGCTCATTACAACCTGAAGTAACTCGAGTTACTTCAGGTTGTAATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009543.1-1506s1c1
Sequence:CCGGGCCAGCTTTCTTCTCTGCATTCTCGAGAATGCAGAGAAGAAAGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009543
VALIDATED
RNF103 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 103
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009543.2-2213s21c1
Sequence:CCGGGACGAAGACCCTGACTTATTCCTCGAGGAATAAGTCAGGGTCTTCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009543.2-1821s21c1
Sequence:CCGGAGCGATTTGTGGTTCTCATAACTCGAGTTATGAGAACCACAAATCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009543.2-2928s21c1
Sequence:CCGGTGACAGGAAATACACATTATGCTCGAGCATAATGTGTATTTCCTGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009543.2-2951s21c1
Sequence:CCGGGATGTTGATGACAGAATTTATCTCGAGATAAATTCTGTCATCAACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009543.1-2845s1c1
Sequence:CCGGGCCTTGAGTATCTTACAGCTTCTCGAGAAGCTGTAAGATACTCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009543.1-1299s1c1
Sequence:CCGGGCCACAAACAAGTACATCTAACTCGAGTTAGATGTACTTGTTTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009543.1-1718s1c1
Sequence:CCGGGCTCATTACAACCTGAAGTAACTCGAGTTACTTCAGGTTGTAATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009543.1-1506s1c1
Sequence:CCGGGCCAGCTTTCTTCTCTGCATTCTCGAGAATGCAGAGAAGAAAGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005667
VALIDATED
RNF103 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 103
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005667.2-1868s21c1
Sequence:CCGGGAAACCACACAGGCGAATTTACTCGAGTAAATTCGCCTGTGTGGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005667.2-1798s21c1
Sequence:CCGGATGACAGATATTGGCATATATCTCGAGATATATGCCAATATCTGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005667.2-3125s21c1
Sequence:CCGGTTAGTGCAGTGACGGGAAATACTCGAGTATTTCCCGTCACTGCACTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005667.2-2474s21c1
Sequence:CCGGCTCTGATACCAACTGATTATACTCGAGTATAATCAGTTGGTATCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005667.2-2502s21c1
Sequence:CCGGCTTACCAATGTGGCGATTTAACTCGAGTTAAATCGCCACATTGGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005667.2-3154s1c1
Sequence:CCGGGCTAATGTTGATGACAGAATTCTCGAGAATTCTGTCATCAACATTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005667.2-1930s1c1
Sequence:CCGGCCCGAGGTAAATGATCTGTTTCTCGAGAAACAGATCATTTACCTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005667.2-2933s1c1
Sequence:CCGGGCCGACATTGTTGCCCTGTTTCTCGAGAAACAGGGCAACAATGTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005667.2-1248s1c1
Sequence:CCGGCGAATCGGTTTCTAGTACCAACTCGAGTTGGTACTAGAAACCGATTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005667.2-2472s1c1
Sequence:CCGGCCCTCTGATACCAACTGATTACTCGAGTAATCAGTTGGTATCAGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005667
VALIDATED
RNF103 MISSION shRNA shRNA Plasmid DNA
ring finger protein 103
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005667.2-1868s21c1
Sequence:CCGGGAAACCACACAGGCGAATTTACTCGAGTAAATTCGCCTGTGTGGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005667.2-1798s21c1
Sequence:CCGGATGACAGATATTGGCATATATCTCGAGATATATGCCAATATCTGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005667.2-3125s21c1
Sequence:CCGGTTAGTGCAGTGACGGGAAATACTCGAGTATTTCCCGTCACTGCACTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005667.2-2474s21c1
Sequence:CCGGCTCTGATACCAACTGATTATACTCGAGTATAATCAGTTGGTATCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005667.2-2502s21c1
Sequence:CCGGCTTACCAATGTGGCGATTTAACTCGAGTTAAATCGCCACATTGGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005667.2-3154s1c1
Sequence:CCGGGCTAATGTTGATGACAGAATTCTCGAGAATTCTGTCATCAACATTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005667.2-1930s1c1
Sequence:CCGGCCCGAGGTAAATGATCTGTTTCTCGAGAAACAGATCATTTACCTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005667.2-2933s1c1
Sequence:CCGGGCCGACATTGTTGCCCTGTTTCTCGAGAAACAGGGCAACAATGTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005667.2-1248s1c1
Sequence:CCGGCGAATCGGTTTCTAGTACCAACTCGAGTTGGTACTAGAAACCGATTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005667.2-2472s1c1
Sequence:CCGGCCCTCTGATACCAACTGATTACTCGAGTAATCAGTTGGTATCAGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005667
VALIDATED
RNF103 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 103
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005667.2-1868s21c1
Sequence:CCGGGAAACCACACAGGCGAATTTACTCGAGTAAATTCGCCTGTGTGGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005667.2-1798s21c1
Sequence:CCGGATGACAGATATTGGCATATATCTCGAGATATATGCCAATATCTGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005667.2-3125s21c1
Sequence:CCGGTTAGTGCAGTGACGGGAAATACTCGAGTATTTCCCGTCACTGCACTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005667.2-2474s21c1
Sequence:CCGGCTCTGATACCAACTGATTATACTCGAGTATAATCAGTTGGTATCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005667.2-2502s21c1
Sequence:CCGGCTTACCAATGTGGCGATTTAACTCGAGTTAAATCGCCACATTGGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005667.2-3154s1c1
Sequence:CCGGGCTAATGTTGATGACAGAATTCTCGAGAATTCTGTCATCAACATTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005667.2-1930s1c1
Sequence:CCGGCCCGAGGTAAATGATCTGTTTCTCGAGAAACAGATCATTTACCTCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005667.2-2933s1c1
Sequence:CCGGGCCGACATTGTTGCCCTGTTTCTCGAGAAACAGGGCAACAATGTCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005667.2-1248s1c1
Sequence:CCGGCGAATCGGTTTCTAGTACCAACTCGAGTTGGTACTAGAAACCGATTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005667.2-2472s1c1
Sequence:CCGGCCCTCTGATACCAACTGATTACTCGAGTAATCAGTTGGTATCAGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)