EMAIL THIS PAGE TO A FRIEND

RNF126

ring finger protein 126

62 Gene Product Result for
UniProtKB ID: Q9BV68, Q9NWX1
Gene ID:
Human(55658) Summary: The protein encoded by this gene contains a RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions. [provided by RefSeq, Jul 2008]
Mouse(70294) ring finger protein 126
Rat(314613) ring finger protein 126
Zebrafish(100009648) ring finger protein 126
domestic cat(101091511) ring finger protein 126
dog(485101) ring finger protein 126
chicken(420085) ring finger protein 126
domestic guinea pig(100720741) ring finger protein 126
naked mole-rat(101720173) ring finger protein 126
cow(507447) ring finger protein 126
sheep(101109015) ring finger protein 126
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144528 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144528 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144528 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017876 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017876 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017876 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_194460 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194460 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194460 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017876 Rosetta Predictions human pricing
NM_194460 Rosetta Predictions human pricing
NM_001033702 Rosetta Predictions rat pricing
NM_144528 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017876 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212700 predicted 351
2 SASI_Hs01_00212701 predicted 688
3 SASI_Hs01_00212702 predicted 796
4 SASI_Hs01_00212703 predicted 674
5 SASI_Hs01_00212704 predicted 679
6 SASI_Hs01_00212705 predicted 356
7 SASI_Hs01_00212706 predicted 446
8 SASI_Hs01_00212707 predicted 627
9 SASI_Hs01_00212708 predicted 346
10 SASI_Hs01_00212709 predicted 625
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151809 predicted 348
2 SASI_Hs01_00151810 predicted 679
3 SASI_Hs01_00151811 predicted 785
4 SASI_Hs01_00151812 predicted 671
5 SASI_Hs01_00151813 predicted 667
6 SASI_Hs02_00371540 predicted 927
7 SASI_Hs02_00371541 predicted 1001
8 SASI_Hs02_00371542 predicted 843
9 SASI_Hs01_00151814 predicted 358
10 SASI_Hs02_00371543 predicted 1017
11 SASI_Hs01_00151815 predicted 450
12 SASI_Hs01_00151816 predicted 628
13 SASI_Hs01_00151817 predicted 345
14 SASI_Hs01_00151818 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033702 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085667 predicted 333
2 SASI_Rn01_00085668 predicted 909
3 SASI_Rn01_00085669 predicted 841
4 SASI_Rn01_00085670 predicted 440
5 SASI_Rn01_00085671 predicted 332
6 SASI_Rn01_00085672 predicted 364
7 SASI_Rn01_00085673 predicted 560
8 SASI_Rn01_00085674 predicted 287
9 SASI_Rn01_00085675 predicted 431
10 SASI_Rn01_00085676 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144528 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138121 predicted 1252
2 SASI_Mm01_00138122 predicted 945
3 SASI_Mm01_00138123 predicted 350
4 SASI_Mm01_00138124 predicted 807
5 SASI_Mm01_00138125 predicted 1282
6 SASI_Mm01_00138126 predicted 905
7 SASI_Mm01_00138127 predicted 341
8 SASI_Mm01_00138128 predicted 816
9 SASI_Mm01_00138129 predicted 836
10 SASI_Mm01_00138130 predicted 545
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144528
RNF126 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 126
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144528.1-345s1c1
Sequence:CCGGCCTTTGGCATCTTCGACGATACTCGAGTATCGTCGAAGATGCCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144528.1-790s1c1
Sequence:CCGGCCCAGTGTGTAAAGAAGACTACTCGAGTAGTCTTCTTTACACACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144528.1-224s1c1
Sequence:CCGGGAGACCAGGAACACAGAGAATCTCGAGATTCTCTGTGTTCCTGGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144528.1-1333s1c1
Sequence:CCGGGCTTTGAAATAAATGGACGTTCTCGAGAACGTCCATTTATTTCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144528.1-679s1c1
Sequence:CCGGGCTCCTCAATCAGTTTGAGAACTCGAGTTCTCAAACTGATTGAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144528
RNF126 MISSION shRNA shRNA Plasmid DNA
ring finger protein 126
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144528.1-345s1c1
Sequence:CCGGCCTTTGGCATCTTCGACGATACTCGAGTATCGTCGAAGATGCCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144528.1-790s1c1
Sequence:CCGGCCCAGTGTGTAAAGAAGACTACTCGAGTAGTCTTCTTTACACACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144528.1-224s1c1
Sequence:CCGGGAGACCAGGAACACAGAGAATCTCGAGATTCTCTGTGTTCCTGGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144528.1-1333s1c1
Sequence:CCGGGCTTTGAAATAAATGGACGTTCTCGAGAACGTCCATTTATTTCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144528.1-679s1c1
Sequence:CCGGGCTCCTCAATCAGTTTGAGAACTCGAGTTCTCAAACTGATTGAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144528
RNF126 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 126
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144528.1-345s1c1
Sequence:CCGGCCTTTGGCATCTTCGACGATACTCGAGTATCGTCGAAGATGCCAAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144528.1-790s1c1
Sequence:CCGGCCCAGTGTGTAAAGAAGACTACTCGAGTAGTCTTCTTTACACACTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144528.1-224s1c1
Sequence:CCGGGAGACCAGGAACACAGAGAATCTCGAGATTCTCTGTGTTCCTGGTCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144528.1-1333s1c1
Sequence:CCGGGCTTTGAAATAAATGGACGTTCTCGAGAACGTCCATTTATTTCAAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144528.1-679s1c1
Sequence:CCGGGCTCCTCAATCAGTTTGAGAACTCGAGTTCTCAAACTGATTGAGGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017876
RNF126 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 126
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022394    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_017876.3-1171s1c1
Sequence:CCGGTGCATGGTTTGTGGCGGAAGACTCGAGTCTTCCGCCACAAACCATGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017876.3-1064s1c1
Sequence:CCGGCCTCTGTCTAACCTCACCCTCCTCGAGGAGGGTGAGGTTAGACAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022398    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_017876.3-1015s1c1
Sequence:CCGGCAACGAGAACGCCACATGGTCCTCGAGGACCATGTGGCGTTCTCGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017876.3-1011s1c1
Sequence:CCGGCCAGCAACGAGAACGCCACATCTCGAGATGTGGCGTTCTCGTTGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017876.3-1014s1c1
Sequence:CCGGGCAACGAGAACGCCACATGGTCTCGAGACCATGTGGCGTTCTCGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017876
RNF126 MISSION shRNA shRNA Plasmid DNA
ring finger protein 126
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022394    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_017876.3-1171s1c1
Sequence:CCGGTGCATGGTTTGTGGCGGAAGACTCGAGTCTTCCGCCACAAACCATGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017876.3-1064s1c1
Sequence:CCGGCCTCTGTCTAACCTCACCCTCCTCGAGGAGGGTGAGGTTAGACAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022398    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_017876.3-1015s1c1
Sequence:CCGGCAACGAGAACGCCACATGGTCCTCGAGGACCATGTGGCGTTCTCGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017876.3-1011s1c1
Sequence:CCGGCCAGCAACGAGAACGCCACATCTCGAGATGTGGCGTTCTCGTTGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017876.3-1014s1c1
Sequence:CCGGGCAACGAGAACGCCACATGGTCTCGAGACCATGTGGCGTTCTCGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017876
RNF126 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 126
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022394    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_017876.3-1171s1c1
Sequence:CCGGTGCATGGTTTGTGGCGGAAGACTCGAGTCTTCCGCCACAAACCATGCATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017876.3-1064s1c1
Sequence:CCGGCCTCTGTCTAACCTCACCCTCCTCGAGGAGGGTGAGGTTAGACAGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022398    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_017876.3-1015s1c1
Sequence:CCGGCAACGAGAACGCCACATGGTCCTCGAGGACCATGTGGCGTTCTCGTTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017876.3-1011s1c1
Sequence:CCGGCCAGCAACGAGAACGCCACATCTCGAGATGTGGCGTTCTCGTTGCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017876.3-1014s1c1
Sequence:CCGGGCAACGAGAACGCCACATGGTCTCGAGACCATGTGGCGTTCTCGTTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194460
VALIDATED
RNF126 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 126
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_194460.1-678s21c1
Sequence:CCGGCACAGCTCCTCAATCAGTTTGCTCGAGCAAACTGATTGAGGAGCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_194460.1-351s21c1
Sequence:CCGGTTGCTTTCGGCATCTTCGATGCTCGAGCATCGAAGATGCCGAAAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_194460.1-189s21c1
Sequence:CCGGTCTGTCCAAGATGCGAGTCTGCTCGAGCAGACTCGCATCTTGGACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256759    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_194460.1-1334s21c1
Sequence:CCGGTTTGAAATAAACGGACGTTTGCTCGAGCAAACGTCCGTTTATTTCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_194460.1-214s21c1
Sequence:CCGGTATCGAGGAGCTTCCGGAAGACTCGAGTCTTCCGGAAGCTCCTCGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_194460.1-655s21c1
Sequence:CCGGCAACGGCCTGGATGCCATCATCTCGAGATGATGGCATCCAGGCCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194460.1-1015s21c1
Sequence:CCGGCAACGAGAACGCCACAAGCAACTCGAGTTGCTTGTGGCGTTCTCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_194460.1-667s21c1
Sequence:CCGGTGCCATCATCACACAGCTCCTCTCGAGAGGAGCTGTGTGATGATGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_194460.1-174s21c1
Sequence:CCGGGCCTGCCGGATTATATCTGTCCTCGAGGACAGATATAATCCGGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194460
VALIDATED
RNF126 MISSION shRNA shRNA Plasmid DNA
ring finger protein 126
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_194460.1-678s21c1
Sequence:CCGGCACAGCTCCTCAATCAGTTTGCTCGAGCAAACTGATTGAGGAGCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_194460.1-351s21c1
Sequence:CCGGTTGCTTTCGGCATCTTCGATGCTCGAGCATCGAAGATGCCGAAAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_194460.1-189s21c1
Sequence:CCGGTCTGTCCAAGATGCGAGTCTGCTCGAGCAGACTCGCATCTTGGACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256759    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_194460.1-1334s21c1
Sequence:CCGGTTTGAAATAAACGGACGTTTGCTCGAGCAAACGTCCGTTTATTTCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_194460.1-214s21c1
Sequence:CCGGTATCGAGGAGCTTCCGGAAGACTCGAGTCTTCCGGAAGCTCCTCGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_194460.1-655s21c1
Sequence:CCGGCAACGGCCTGGATGCCATCATCTCGAGATGATGGCATCCAGGCCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194460.1-1015s21c1
Sequence:CCGGCAACGAGAACGCCACAAGCAACTCGAGTTGCTTGTGGCGTTCTCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_194460.1-667s21c1
Sequence:CCGGTGCCATCATCACACAGCTCCTCTCGAGAGGAGCTGTGTGATGATGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_194460.1-174s21c1
Sequence:CCGGGCCTGCCGGATTATATCTGTCCTCGAGGACAGATATAATCCGGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194460
VALIDATED
RNF126 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 126
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_194460.1-678s21c1
Sequence:CCGGCACAGCTCCTCAATCAGTTTGCTCGAGCAAACTGATTGAGGAGCTGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_194460.1-351s21c1
Sequence:CCGGTTGCTTTCGGCATCTTCGATGCTCGAGCATCGAAGATGCCGAAAGCAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_194460.1-189s21c1
Sequence:CCGGTCTGTCCAAGATGCGAGTCTGCTCGAGCAGACTCGCATCTTGGACAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256759    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_194460.1-1334s21c1
Sequence:CCGGTTTGAAATAAACGGACGTTTGCTCGAGCAAACGTCCGTTTATTTCAAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_194460.1-214s21c1
Sequence:CCGGTATCGAGGAGCTTCCGGAAGACTCGAGTCTTCCGGAAGCTCCTCGATATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_194460.1-655s21c1
Sequence:CCGGCAACGGCCTGGATGCCATCATCTCGAGATGATGGCATCCAGGCCGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194460.1-1015s21c1
Sequence:CCGGCAACGAGAACGCCACAAGCAACTCGAGTTGCTTGTGGCGTTCTCGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_194460.1-667s21c1
Sequence:CCGGTGCCATCATCACACAGCTCCTCTCGAGAGGAGCTGTGTGATGATGGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_194460.1-174s21c1
Sequence:CCGGGCCTGCCGGATTATATCTGTCCTCGAGGACAGATATAATCCGGCAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)