EMAIL THIS PAGE TO A FRIEND

RNF145

ring finger protein 145

150 Gene Product Result for
UniProtKB ID: Q96MT1, B7Z903, B7Z949, E7EVI7, Q8IVP7
Gene ID:
Mouse(74315) ring finger protein 145
Rat(287212) ring finger protein 145
naked mole-rat(101702012) ring finger protein 145
Domestic Rabbit(100351646) ring finger protein 145
domestic guinea pig(100733242) ring finger protein 145
cow(534282) ring finger protein 145
sheep(101115120) ring finger protein 145
chicken(416239) ring finger protein 145
dog(489154) ring finger protein 145
domestic cat(101081701) ring finger protein 145
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144726 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144726 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144726 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028862 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028862 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028862 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144726 Rosetta Predictions human pricing
NM_001105778 Rosetta Predictions rat pricing
NM_028862 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126544 predicted 1915
2 SASI_Hs01_00126545 predicted 692
3 SASI_Hs01_00126547 predicted 714
4 SASI_Hs01_00126548 predicted 603
5 SASI_Hs01_00126550 predicted 400
6 SASI_Hs01_00126551 predicted 1211
7 SASI_Hs01_00126552 predicted 1565
8 SASI_Hs01_00126553 predicted 1292
9 SASI_Hs02_00364679 predicted 1005
10 SASI_Hs02_00364680 predicted 1864
11 SASI_Hs01_00126546 predicted 1978
12 SASI_Hs01_00126549 predicted 2122
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105778 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212436 predicted 910
2 SASI_Rn02_00212437 predicted 326
3 SASI_Rn02_00212438 predicted 1954
4 SASI_Rn02_00212439 predicted 574
5 SASI_Rn02_00212440 predicted 1462
6 SASI_Rn02_00212441 predicted 997
7 SASI_Rn02_00212442 predicted 541
8 SASI_Rn02_00212443 predicted 1580
9 SASI_Rn02_00212444 predicted 529
10 SASI_Rn02_00212445 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028862 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022014 predicted 663
2 SASI_Mm01_00022015 predicted 1327
3 SASI_Mm01_00022016 predicted 515
4 SASI_Mm01_00022017 predicted 889
5 SASI_Mm01_00022018 predicted 1349
6 SASI_Mm01_00022019 predicted 675
7 SASI_Mm01_00022020 predicted 456
8 SASI_Mm01_00022021 predicted 1385
9 SASI_Mm01_00022022 predicted 2283
10 SASI_Mm01_00022023 predicted 612
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144726
VALIDATED
RNF145 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 145
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144726.1-229s21c1
Sequence:CCGGAGAAGTAGCCTTAGTAATAACCTCGAGGTTATTACTAAGGCTACTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423175    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144726.1-2211s21c1
Sequence:CCGGCTGACATTCCAAGGATCTAATCTCGAGATTAGATCCTTGGAATGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144726.1-2007s21c1
Sequence:CCGGCATTGCCAGACGACCAGATAACTCGAGTTATCTGGTCGTCTGGCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144726.1-283s21c1
Sequence:CCGGATGCATTATGTAGGTTATATCCTCGAGGATATAACCTACATAATGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034119    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144726.1-2606s1c1
Sequence:CCGGAGGTGATTATTGAGTCTTGTACTCGAGTACAAGACTCAATAATCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144726.1-460s1c1
Sequence:CCGGCCTCTCTCTATGAATCGGTTTCTCGAGAAACCGATTCATAGAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144726.1-1545s1c1
Sequence:CCGGCTTTGGAGAATGGACAGTGATCTCGAGATCACTGTCCATTCTCCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_144726.1-923s1c1
Sequence:CCGGGCAGCACTCCTTACTCTCTTTCTCGAGAAAGAGAGTAAGGAGTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144726.1-1008s1c1
Sequence:CCGGGCAGGGTTATCGAGCTTTCATCTCGAGATGAAAGCTCGATAACCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144726
VALIDATED
RNF145 MISSION shRNA shRNA Plasmid DNA
ring finger protein 145
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144726.1-229s21c1
Sequence:CCGGAGAAGTAGCCTTAGTAATAACCTCGAGGTTATTACTAAGGCTACTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423175    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144726.1-2211s21c1
Sequence:CCGGCTGACATTCCAAGGATCTAATCTCGAGATTAGATCCTTGGAATGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144726.1-2007s21c1
Sequence:CCGGCATTGCCAGACGACCAGATAACTCGAGTTATCTGGTCGTCTGGCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144726.1-283s21c1
Sequence:CCGGATGCATTATGTAGGTTATATCCTCGAGGATATAACCTACATAATGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034119    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144726.1-2606s1c1
Sequence:CCGGAGGTGATTATTGAGTCTTGTACTCGAGTACAAGACTCAATAATCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144726.1-460s1c1
Sequence:CCGGCCTCTCTCTATGAATCGGTTTCTCGAGAAACCGATTCATAGAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144726.1-1545s1c1
Sequence:CCGGCTTTGGAGAATGGACAGTGATCTCGAGATCACTGTCCATTCTCCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_144726.1-923s1c1
Sequence:CCGGGCAGCACTCCTTACTCTCTTTCTCGAGAAAGAGAGTAAGGAGTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144726.1-1008s1c1
Sequence:CCGGGCAGGGTTATCGAGCTTTCATCTCGAGATGAAAGCTCGATAACCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144726
VALIDATED
RNF145 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 145
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144726.1-229s21c1
Sequence:CCGGAGAAGTAGCCTTAGTAATAACCTCGAGGTTATTACTAAGGCTACTTCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423175    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144726.1-2211s21c1
Sequence:CCGGCTGACATTCCAAGGATCTAATCTCGAGATTAGATCCTTGGAATGTCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144726.1-2007s21c1
Sequence:CCGGCATTGCCAGACGACCAGATAACTCGAGTTATCTGGTCGTCTGGCAATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144726.1-283s21c1
Sequence:CCGGATGCATTATGTAGGTTATATCCTCGAGGATATAACCTACATAATGCATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034119    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144726.1-2606s1c1
Sequence:CCGGAGGTGATTATTGAGTCTTGTACTCGAGTACAAGACTCAATAATCACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144726.1-460s1c1
Sequence:CCGGCCTCTCTCTATGAATCGGTTTCTCGAGAAACCGATTCATAGAGAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144726.1-1545s1c1
Sequence:CCGGCTTTGGAGAATGGACAGTGATCTCGAGATCACTGTCCATTCTCCAAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_144726.1-923s1c1
Sequence:CCGGGCAGCACTCCTTACTCTCTTTCTCGAGAAAGAGAGTAAGGAGTGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144726.1-1008s1c1
Sequence:CCGGGCAGGGTTATCGAGCTTTCATCTCGAGATGAAAGCTCGATAACCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028862
VALIDATED
RNF145 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 145
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028862.1-2837s1c1
Sequence:CCGGCGCAATGAAATCAAAGATGTACTCGAGTACATCTTTGATTTCATTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028862.1-1887s1c1
Sequence:CCGGGCTGTGAATAAGATTAAGTCTCTCGAGAGACTTAATCTTATTCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028862.1-910s1c1
Sequence:CCGGCTAATCTCCTAGTACCGTATACTCGAGTATACGGTACTAGGAGATTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028862.1-667s1c1
Sequence:CCGGCCTATGAAGGACCAATGTATTCTCGAGAATACATTGGTCCTTCATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028862.2-1882s21c1
Sequence:GTACCGGGGACGCTGTGAATAAGATTAACTCGAGTTAATCTTATTCACAGCGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028862.2-1511s21c1
Sequence:CCGGCTCGTGTTCCCTGCGTATATGCTCGAGCATATACGCAGGGAACACGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028862.2-910s21c1
Sequence:CCGGTAATCTCCTAGTACCGTATAACTCGAGTTATACGGTACTAGGAGATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226317    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028862.2-2615s21c1
Sequence:CCGGCCCTGATTTGCGAGGGATAATCTCGAGATTATCCCTCGCAAATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028862.2-514s21c1
Sequence:CCGGTATGCATTACGTAGGTTATATCTCGAGATATAACCTACGTAATGCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028862
VALIDATED
RNF145 MISSION shRNA shRNA Plasmid DNA
ring finger protein 145
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028862.1-2837s1c1
Sequence:CCGGCGCAATGAAATCAAAGATGTACTCGAGTACATCTTTGATTTCATTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028862.1-1887s1c1
Sequence:CCGGGCTGTGAATAAGATTAAGTCTCTCGAGAGACTTAATCTTATTCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028862.1-910s1c1
Sequence:CCGGCTAATCTCCTAGTACCGTATACTCGAGTATACGGTACTAGGAGATTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028862.1-667s1c1
Sequence:CCGGCCTATGAAGGACCAATGTATTCTCGAGAATACATTGGTCCTTCATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028862.2-1882s21c1
Sequence:GTACCGGGGACGCTGTGAATAAGATTAACTCGAGTTAATCTTATTCACAGCGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028862.2-1511s21c1
Sequence:CCGGCTCGTGTTCCCTGCGTATATGCTCGAGCATATACGCAGGGAACACGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028862.2-910s21c1
Sequence:CCGGTAATCTCCTAGTACCGTATAACTCGAGTTATACGGTACTAGGAGATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226317    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028862.2-2615s21c1
Sequence:CCGGCCCTGATTTGCGAGGGATAATCTCGAGATTATCCCTCGCAAATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028862.2-514s21c1
Sequence:CCGGTATGCATTACGTAGGTTATATCTCGAGATATAACCTACGTAATGCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028862
VALIDATED
RNF145 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 145
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028862.1-2837s1c1
Sequence:CCGGCGCAATGAAATCAAAGATGTACTCGAGTACATCTTTGATTTCATTGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028862.1-1887s1c1
Sequence:CCGGGCTGTGAATAAGATTAAGTCTCTCGAGAGACTTAATCTTATTCACAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028862.1-910s1c1
Sequence:CCGGCTAATCTCCTAGTACCGTATACTCGAGTATACGGTACTAGGAGATTAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028862.1-667s1c1
Sequence:CCGGCCTATGAAGGACCAATGTATTCTCGAGAATACATTGGTCCTTCATAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028862.2-1882s21c1
Sequence:GTACCGGGGACGCTGTGAATAAGATTAACTCGAGTTAATCTTATTCACAGCGTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028862.2-1511s21c1
Sequence:CCGGCTCGTGTTCCCTGCGTATATGCTCGAGCATATACGCAGGGAACACGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028862.2-910s21c1
Sequence:CCGGTAATCTCCTAGTACCGTATAACTCGAGTTATACGGTACTAGGAGATTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226317    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028862.2-2615s21c1
Sequence:CCGGCCCTGATTTGCGAGGGATAATCTCGAGATTATCCCTCGCAAATCAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028862.2-514s21c1
Sequence:CCGGTATGCATTACGTAGGTTATATCTCGAGATATAACCTACGTAATGCATATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)