EMAIL THIS PAGE TO A FRIEND

RNF146

ring finger protein 146

146 Gene Product Result for
Synonyms: RP3-351K20.1 dJ351K20.1
Gene ID:
Mouse(68031) ring finger protein 146
Rat(308051) ring finger protein 146
Zebrafish(334065) ring finger protein 146
chicken(425313) ring finger protein 146
domestic cat(101085893) ring finger protein 146
Horse(100067400) ring finger protein 146
dog(476288) ring finger protein 146
sheep(101116736) ring finger protein 146
domestic guinea pig(100719837) ring finger protein 146
naked mole-rat(101720640) ring finger protein 146
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030963 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030963 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030963 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026518 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026518 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026518 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030963 Rosetta Predictions human pricing
NM_001012060 Rosetta Predictions rat pricing
XM_574289 Rosetta Predictions rat pricing
NM_001110196 Rosetta Predictions mouse pricing
NM_001110197 Rosetta Predictions mouse pricing
NM_001110198 Rosetta Predictions mouse pricing
NM_026518 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239254 predicted 880
2 SASI_Hs02_00358545 predicted 890
3 SASI_Hs01_00239257 predicted 1499
4 SASI_Hs01_00239258 predicted 518
5 SASI_Hs01_00239259 predicted 1111
6 SASI_Hs01_00239260 predicted 1249
7 SASI_Hs01_00239261 predicted 925
8 SASI_Hs02_00358546 predicted 706
9 SASI_Hs01_00239262 predicted 669
10 SASI_Hs02_00358547 predicted 1157
11 SASI_Hs01_00239253 predicted 900
12 SASI_Hs01_00239255 predicted 1273
13 SASI_Hs01_00239256 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012060 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054441 predicted 574
2 SASI_Rn01_00054442 predicted 711
3 SASI_Rn01_00054443 predicted 1236
4 SASI_Rn01_00054444 predicted 1252
5 SASI_Rn01_00054445 predicted 873
6 SASI_Rn01_00054446 predicted 1223
7 SASI_Rn01_00054447 predicted 1000
8 SASI_Rn01_00054448 predicted 556
9 SASI_Rn02_00200165 predicted 1217
10 SASI_Rn01_00054449 predicted 647
11 SASI_Rn01_00054450 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574289 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00151774 predicted 612
2 SASI_Rn01_00151775 predicted 748
3 SASI_Rn01_00151776 predicted 1270
4 SASI_Rn01_00151777 predicted 1282
5 SASI_Rn01_00151778 predicted 907
6 SASI_Rn01_00151779 predicted 1266
7 SASI_Rn01_00151780 predicted 1034
8 SASI_Rn01_00151781 predicted 593
9 SASI_Rn01_00151782 predicted 684
10 SASI_Rn01_00151783 predicted 870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110196 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304856 predicted 733
2 SASI_Mm02_00304857 predicted 691
3 SASI_Mm02_00304858 predicted 1746
4 SASI_Mm02_00304859 predicted 1123
5 SASI_Mm02_00304860 predicted 743
6 SASI_Mm02_00304861 predicted 1308
7 SASI_Mm02_00304862 predicted 1707
8 SASI_Mm02_00304863 predicted 1543
9 SASI_Mm02_00304864 predicted 1391
10 SASI_Mm02_00304865 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110197 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304866 predicted 795
2 SASI_Mm02_00304867 predicted 751
3 SASI_Mm02_00304868 predicted 1811
4 SASI_Mm02_00304869 predicted 1177
5 SASI_Mm02_00304870 predicted 800
6 SASI_Mm02_00304871 predicted 1375
7 SASI_Mm02_00304872 predicted 1764
8 SASI_Mm02_00304873 predicted 1606
9 SASI_Mm02_00304874 predicted 1456
10 SASI_Mm02_00304875 predicted 1250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110198 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304876 predicted 773
2 SASI_Mm02_00304877 predicted 727
3 SASI_Mm02_00304878 predicted 1792
4 SASI_Mm02_00304879 predicted 1158
5 SASI_Mm02_00304880 predicted 783
6 SASI_Mm02_00304881 predicted 1354
7 SASI_Mm02_00304882 predicted 1744
8 SASI_Mm02_00304883 predicted 1581
9 SASI_Mm02_00304884 predicted 1439
10 SASI_Mm02_00304885 predicted 1230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026518 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044085 predicted 710
2 SASI_Mm01_00044086 predicted 670
3 SASI_Mm01_00044087 predicted 1731
4 SASI_Mm02_00330427 predicted 1103
5 SASI_Mm01_00044089 predicted 722
6 SASI_Mm01_00044090 predicted 1292
7 SASI_Mm01_00044091 predicted 1682
8 SASI_Mm02_00330428 predicted 1519
9 SASI_Mm01_00044092 predicted 1380
10 SASI_Mm01_00044093 predicted 1165
11 SASI_Mm01_00044084 predicted 636
12 SASI_Mm01_00044088 predicted 1108
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030963
VALIDATED
RNF146 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 146
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030963.2-1864s1c1
Sequence:CCGGCCTGTGAGATGTTTGATATTACTCGAGTAATATCAAACATCTCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030963.2-1270s1c1
Sequence:CCGGGCCAGTAGTGATAGTGAGGATCTCGAGATCCTCACTATCACTACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030963.2-1138s1c1
Sequence:CCGGGCTCATTTACAACTCAGTGGACTCGAGTCCACTGAGTTGTAAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030963.2-467s1c1
Sequence:CCGGCCTGTTCTAATACTGCACCTTCTCGAGAAGGTGCAGTATTAGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030963.2-884s1c1
Sequence:CCGGGCAGGAAGATTAAGCGAGATACTCGAGTATCTCGCTTAATCTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030963.2-700s21c1
Sequence:CCGGGGTGAATATGCATGGTATTATCTCGAGATAATACCATGCATATTCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030963.2-949s21c1
Sequence:CCGGTGTGATGCTAATACCGTAAACCTCGAGGTTTACGGTATTAGCATCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030963.2-467s21c1
Sequence:CCGGCCTGTTCTAATACTGCACCTTCTCGAGAAGGTGCAGTATTAGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030963.2-1835s21c1
Sequence:CCGGTGGCATAAGACCATTACTAAACTCGAGTTTAGTAATGGTCTTATGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030963.2-1456s21c1
Sequence:CCGGTGCACAGTAACTGAAGTTTAACTCGAGTTAAACTTCAGTTACTGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030963
VALIDATED
RNF146 MISSION shRNA shRNA Plasmid DNA
ring finger protein 146
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030963.2-1864s1c1
Sequence:CCGGCCTGTGAGATGTTTGATATTACTCGAGTAATATCAAACATCTCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030963.2-1270s1c1
Sequence:CCGGGCCAGTAGTGATAGTGAGGATCTCGAGATCCTCACTATCACTACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030963.2-1138s1c1
Sequence:CCGGGCTCATTTACAACTCAGTGGACTCGAGTCCACTGAGTTGTAAATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030963.2-467s1c1
Sequence:CCGGCCTGTTCTAATACTGCACCTTCTCGAGAAGGTGCAGTATTAGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030963.2-884s1c1
Sequence:CCGGGCAGGAAGATTAAGCGAGATACTCGAGTATCTCGCTTAATCTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030963.2-700s21c1
Sequence:CCGGGGTGAATATGCATGGTATTATCTCGAGATAATACCATGCATATTCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030963.2-949s21c1
Sequence:CCGGTGTGATGCTAATACCGTAAACCTCGAGGTTTACGGTATTAGCATCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030963.2-467s21c1
Sequence:CCGGCCTGTTCTAATACTGCACCTTCTCGAGAAGGTGCAGTATTAGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030963.2-1835s21c1
Sequence:CCGGTGGCATAAGACCATTACTAAACTCGAGTTTAGTAATGGTCTTATGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030963.2-1456s21c1
Sequence:CCGGTGCACAGTAACTGAAGTTTAACTCGAGTTAAACTTCAGTTACTGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030963
VALIDATED
RNF146 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 146
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030963.2-1864s1c1
Sequence:CCGGCCTGTGAGATGTTTGATATTACTCGAGTAATATCAAACATCTCACAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000033982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030963.2-1270s1c1
Sequence:CCGGGCCAGTAGTGATAGTGAGGATCTCGAGATCCTCACTATCACTACTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000033983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030963.2-1138s1c1
Sequence:CCGGGCTCATTTACAACTCAGTGGACTCGAGTCCACTGAGTTGTAAATGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000033981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030963.2-467s1c1
Sequence:CCGGCCTGTTCTAATACTGCACCTTCTCGAGAAGGTGCAGTATTAGAACAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000033980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030963.2-884s1c1
Sequence:CCGGGCAGGAAGATTAAGCGAGATACTCGAGTATCTCGCTTAATCTTCCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000295948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030963.2-700s21c1
Sequence:CCGGGGTGAATATGCATGGTATTATCTCGAGATAATACCATGCATATTCACCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000295951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030963.2-949s21c1
Sequence:CCGGTGTGATGCTAATACCGTAAACCTCGAGGTTTACGGTATTAGCATCACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000298725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030963.2-467s21c1
Sequence:CCGGCCTGTTCTAATACTGCACCTTCTCGAGAAGGTGCAGTATTAGAACAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000295949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030963.2-1835s21c1
Sequence:CCGGTGGCATAAGACCATTACTAAACTCGAGTTTAGTAATGGTCTTATGCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000295950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030963.2-1456s21c1
Sequence:CCGGTGCACAGTAACTGAAGTTTAACTCGAGTTAAACTTCAGTTACTGTGCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026518
VALIDATED
RNF146 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 146
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026518.2-1458s1c1
Sequence:CCGGCCTCCGTTGAAGAAACAGAATCTCGAGATTCTGTTTCTTCAACGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026518.2-684s1c1
Sequence:CCGGCCTGTTCCAATACTGCACCTTCTCGAGAAGGTGCAGTATTGGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026518.2-837s1c1
Sequence:CCGGGACAAGAGATTCCTGAGGATTCTCGAGAATCCTCAGGAATCTCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026518.2-659s1c1
Sequence:CCGGCCTACAAATAAGAAGGCAAATCTCGAGATTTGCCTTCTTATTTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026518.2-1020s1c1
Sequence:CCGGCGGAAATGTTAATTGCTGGATCTCGAGATCCAGCAATTAACATTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026518.4-684s21c1
Sequence:CCGGCCTGTTCCAATACTGCACCTTCTCGAGAAGGTGCAGTATTGGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026518.4-1020s21c1
Sequence:CCGGCGGAAATGTTAATTGCTGGATCTCGAGATCCAGCAATTAACATTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026518.4-1458s21c1
Sequence:CCGGCCTCCGTTGAAGAAACAGAATCTCGAGATTCTGTTTCTTCAACGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026518.4-1738s21c1
Sequence:CCGGATTTCTGCCCACGTAACATTACTCGAGTAATGTTACGTGGGCAGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026518.4-837s21c1
Sequence:CCGGGACAAGAGATTCCTGAGGATTCTCGAGAATCCTCAGGAATCTCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026518
VALIDATED
RNF146 MISSION shRNA shRNA Plasmid DNA
ring finger protein 146
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026518.2-1458s1c1
Sequence:CCGGCCTCCGTTGAAGAAACAGAATCTCGAGATTCTGTTTCTTCAACGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026518.2-684s1c1
Sequence:CCGGCCTGTTCCAATACTGCACCTTCTCGAGAAGGTGCAGTATTGGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026518.2-837s1c1
Sequence:CCGGGACAAGAGATTCCTGAGGATTCTCGAGAATCCTCAGGAATCTCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026518.2-659s1c1
Sequence:CCGGCCTACAAATAAGAAGGCAAATCTCGAGATTTGCCTTCTTATTTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026518.2-1020s1c1
Sequence:CCGGCGGAAATGTTAATTGCTGGATCTCGAGATCCAGCAATTAACATTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026518.4-684s21c1
Sequence:CCGGCCTGTTCCAATACTGCACCTTCTCGAGAAGGTGCAGTATTGGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026518.4-1020s21c1
Sequence:CCGGCGGAAATGTTAATTGCTGGATCTCGAGATCCAGCAATTAACATTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026518.4-1458s21c1
Sequence:CCGGCCTCCGTTGAAGAAACAGAATCTCGAGATTCTGTTTCTTCAACGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026518.4-1738s21c1
Sequence:CCGGATTTCTGCCCACGTAACATTACTCGAGTAATGTTACGTGGGCAGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026518.4-837s21c1
Sequence:CCGGGACAAGAGATTCCTGAGGATTCTCGAGAATCCTCAGGAATCTCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026518
VALIDATED
RNF146 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 146
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026518.2-1458s1c1
Sequence:CCGGCCTCCGTTGAAGAAACAGAATCTCGAGATTCTGTTTCTTCAACGGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000040726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026518.2-684s1c1
Sequence:CCGGCCTGTTCCAATACTGCACCTTCTCGAGAAGGTGCAGTATTGGAACAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000040727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026518.2-837s1c1
Sequence:CCGGGACAAGAGATTCCTGAGGATTCTCGAGAATCCTCAGGAATCTCTTGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000040725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026518.2-659s1c1
Sequence:CCGGCCTACAAATAAGAAGGCAAATCTCGAGATTTGCCTTCTTATTTGTAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000040724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026518.2-1020s1c1
Sequence:CCGGCGGAAATGTTAATTGCTGGATCTCGAGATCCAGCAATTAACATTTCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000332639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026518.4-684s21c1
Sequence:CCGGCCTGTTCCAATACTGCACCTTCTCGAGAAGGTGCAGTATTGGAACAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000332722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026518.4-1020s21c1
Sequence:CCGGCGGAAATGTTAATTGCTGGATCTCGAGATCCAGCAATTAACATTTCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000332640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026518.4-1458s21c1
Sequence:CCGGCCTCCGTTGAAGAAACAGAATCTCGAGATTCTGTTTCTTCAACGGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000306563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026518.4-1738s21c1
Sequence:CCGGATTTCTGCCCACGTAACATTACTCGAGTAATGTTACGTGGGCAGAAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000332641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026518.4-837s21c1
Sequence:CCGGGACAAGAGATTCCTGAGGATTCTCGAGAATCCTCAGGAATCTCTTGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???