EMAIL THIS PAGE TO A FRIEND

RNF14

ring finger protein 14

158 Gene Product Result for
Synonyms: ARA54 HFB30 TRIAD2
Gene ID:
Human(9604) Summary: The protein encoded by this gene contains a RING zinc finger, a motif known to be involved in protein-protein interactions. This protein interacts with androgen receptor (AR) and may function as a coactivator that induces AR target gene expression in prostate. A dominant negative mutant of this gene has been demonstrated to inhibit the AR-mediated growth of prostate cancer. This protein also interacts with class III ubiquitin-conjugating enzymes (E2s) and may act as a ubiquitin-ligase (E3) in the ubiquitination of certain nuclear proteins. Six alternatively spliced transcript variants encoding two distinct isoforms have been reported. [provided by RefSeq, Jan 2011]
Mouse(56736) ring finger protein 14
Rat(619577) ring finger protein 14
Zebrafish(415177) ring finger protein 14
chicken(416340) ring finger protein 14
domestic cat(101081275) ring finger protein 14
dog(478042) ring finger protein 14
Domestic Rabbit(100355608) ring finger protein 14
naked mole-rat(101714536) ring finger protein 14
domestic guinea pig(100725874) ring finger protein 14
cow(540274) ring finger protein 14
sheep(101108651) ring finger protein 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004290 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004290 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004290 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020012 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020012 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020012 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004290 Rosetta Predictions human pricing
NM_183398 Rosetta Predictions human pricing
NM_183399 Rosetta Predictions human pricing
NM_183400 Rosetta Predictions human pricing
NM_183401 Rosetta Predictions human pricing
NM_001034995 Rosetta Predictions rat pricing
NM_020012 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004290 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059196 predicted 962
2 SASI_Hs01_00059197 predicted 1131
3 SASI_Hs01_00059198 predicted 1421
4 SASI_Hs01_00059199 predicted 882
5 SASI_Hs01_00059200 predicted 1625
6 SASI_Hs01_00059202 predicted 872
7 SASI_Hs01_00059203 predicted 973
8 SASI_Hs01_00059204 predicted 1593
9 SASI_Hs01_00059205 predicted 1725
10 SASI_Hs02_00337294 predicted 1532
11 SASI_Hs01_00059201 predicted 1010
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221532 predicted 812
2 SASI_Hs01_00221533 predicted 972
3 SASI_Hs01_00221534 predicted 1269
4 SASI_Hs01_00221535 predicted 734
5 SASI_Hs01_00221536 predicted 1473
6 SASI_Hs01_00221538 predicted 722
7 SASI_Hs01_00221539 predicted 815
8 SASI_Hs01_00221540 predicted 1445
9 SASI_Hs01_00221541 predicted 1577
10 SASI_Hs02_00371305 predicted 1377
11 SASI_Hs01_00221537 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126134 predicted 711
2 SASI_Hs01_00126135 predicted 879
3 SASI_Hs01_00126136 predicted 1169
4 SASI_Hs01_00126137 predicted 630
5 SASI_Hs01_00126138 predicted 1367
6 SASI_Hs01_00126140 predicted 621
7 SASI_Hs01_00126141 predicted 715
8 SASI_Hs01_00126142 predicted 1344
9 SASI_Hs01_00126143 predicted 1470
10 SASI_Hs02_00371306 predicted 1282
11 SASI_Hs01_00126139 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183400 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165556 predicted 784
2 SASI_Hs01_00165557 predicted 958
3 SASI_Hs01_00165558 predicted 1254
4 SASI_Hs01_00165559 predicted 708
5 SASI_Hs01_00165560 predicted 1446
6 SASI_Hs01_00165562 predicted 700
7 SASI_Hs01_00165563 predicted 798
8 SASI_Hs01_00165564 predicted 1424
9 SASI_Hs01_00165565 predicted 1552
10 SASI_Hs02_00371307 predicted 1357
11 SASI_Hs01_00165561 predicted 836
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183401 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032529 predicted 919
2 SASI_Hs01_00032530 predicted 1087
3 SASI_Hs01_00032531 predicted 1383
4 SASI_Hs01_00032532 predicted 836
5 SASI_Hs01_00032533 predicted 1580
6 SASI_Hs01_00032535 predicted 825
7 SASI_Hs01_00032536 predicted 932
8 SASI_Hs01_00032537 predicted 1555
9 SASI_Hs01_00032538 predicted 1680
10 SASI_Hs02_00371308 predicted 1487
11 SASI_Hs01_00032534 predicted 962
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034995 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204155 predicted 267
2 SASI_Rn02_00204156 predicted 444
3 SASI_Rn02_00204157 predicted 1141
4 SASI_Rn02_00204158 predicted 1525
5 SASI_Rn02_00204159 predicted 1573
6 SASI_Rn02_00204160 predicted 1750
7 SASI_Rn02_00204161 predicted 1658
8 SASI_Rn02_00204162 predicted 1591
9 SASI_Rn02_00204163 predicted 1106
10 SASI_Rn02_00204164 predicted 1673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020012 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086451 predicted 972
2 SASI_Mm01_00086453 predicted 1009
3 SASI_Mm01_00086454 predicted 1393
4 SASI_Mm01_00086455 predicted 516
5 SASI_Mm01_00086456 predicted 963
6 SASI_Mm01_00086458 predicted 1616
7 SASI_Mm01_00086459 predicted 1568
8 SASI_Mm02_00325385 predicted 854
9 SASI_Mm01_00086460 predicted 1146
10 SASI_Mm02_00325386 predicted 875
11 SASI_Mm01_00086452 predicted 502
12 SASI_Mm01_00086457 predicted 1390
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004290
VALIDATED
RNF14 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 14
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004290.3-1135s21c1
Sequence:CCGGTTAGTGGAAGCAGAGTTATTTCTCGAGAAATAACTCTGCTTCCACTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004290.3-1556s21c1
Sequence:CCGGGTACTGGCTGTATGCAATATTCTCGAGAATATTGCATACAGCCAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004290.3-1673s21c1
Sequence:CCGGTGGATGTTGACGACGATATTTCTCGAGAAATATCGTCGTCAACATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004290.3-1779s21c1
Sequence:CCGGAGTAACTTTGCGGGATATTTACTCGAGTAAATATCCCGCAAAGTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004290.3-1387s21c1
Sequence:CCGGCAAGCGGATGAGGCTAATAAACTCGAGTTTATTAGCCTCATCCGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_004290.x-972s1c1
Sequence:CCGGGCTGGGTAGTGAATGCATGTACTCGAGTACATGCATTCACTACCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004290.x-1973s1c1
Sequence:CCGGCCCAAAGCTCTGAATAGTTAACTCGAGTTAACTATTCAGAGCTTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004290.x-553s1c1
Sequence:CCGGCCACCTTCATTCACACTTAGTCTCGAGACTAAGTGTGAATGAAGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_004290.x-1423s1c1
Sequence:CCGGAGGTATGGTAAGAGAGTGATTCTCGAGAATCACTCTCTTACCATACCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_004290.x-1670s1c1
Sequence:CCGGCTGTGGATGTTGACGACGATACTCGAGTATCGTCGTCAACATCCACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004290
VALIDATED
RNF14 MISSION shRNA shRNA Plasmid DNA
ring finger protein 14
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004290.3-1135s21c1
Sequence:CCGGTTAGTGGAAGCAGAGTTATTTCTCGAGAAATAACTCTGCTTCCACTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004290.3-1556s21c1
Sequence:CCGGGTACTGGCTGTATGCAATATTCTCGAGAATATTGCATACAGCCAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004290.3-1673s21c1
Sequence:CCGGTGGATGTTGACGACGATATTTCTCGAGAAATATCGTCGTCAACATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004290.3-1779s21c1
Sequence:CCGGAGTAACTTTGCGGGATATTTACTCGAGTAAATATCCCGCAAAGTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004290.3-1387s21c1
Sequence:CCGGCAAGCGGATGAGGCTAATAAACTCGAGTTTATTAGCCTCATCCGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_004290.x-972s1c1
Sequence:CCGGGCTGGGTAGTGAATGCATGTACTCGAGTACATGCATTCACTACCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004290.x-1973s1c1
Sequence:CCGGCCCAAAGCTCTGAATAGTTAACTCGAGTTAACTATTCAGAGCTTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004290.x-553s1c1
Sequence:CCGGCCACCTTCATTCACACTTAGTCTCGAGACTAAGTGTGAATGAAGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_004290.x-1423s1c1
Sequence:CCGGAGGTATGGTAAGAGAGTGATTCTCGAGAATCACTCTCTTACCATACCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_004290.x-1670s1c1
Sequence:CCGGCTGTGGATGTTGACGACGATACTCGAGTATCGTCGTCAACATCCACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004290
VALIDATED
RNF14 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 14
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004290.3-1135s21c1
Sequence:CCGGTTAGTGGAAGCAGAGTTATTTCTCGAGAAATAACTCTGCTTCCACTAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000231558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004290.3-1556s21c1
Sequence:CCGGGTACTGGCTGTATGCAATATTCTCGAGAATATTGCATACAGCCAGTACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000231559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004290.3-1673s21c1
Sequence:CCGGTGGATGTTGACGACGATATTTCTCGAGAAATATCGTCGTCAACATCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000231560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004290.3-1779s21c1
Sequence:CCGGAGTAACTTTGCGGGATATTTACTCGAGTAAATATCCCGCAAAGTTACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000257357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004290.3-1387s21c1
Sequence:CCGGCAAGCGGATGAGGCTAATAAACTCGAGTTTATTAGCCTCATCCGCTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000010785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_004290.x-972s1c1
Sequence:CCGGGCTGGGTAGTGAATGCATGTACTCGAGTACATGCATTCACTACCCAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000003444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004290.x-1973s1c1
Sequence:CCGGCCCAAAGCTCTGAATAGTTAACTCGAGTTAACTATTCAGAGCTTTGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000003443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004290.x-553s1c1
Sequence:CCGGCCACCTTCATTCACACTTAGTCTCGAGACTAAGTGTGAATGAAGGTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000003442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_004290.x-1423s1c1
Sequence:CCGGAGGTATGGTAAGAGAGTGATTCTCGAGAATCACTCTCTTACCATACCTTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000010786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_004290.x-1670s1c1
Sequence:CCGGCTGTGGATGTTGACGACGATACTCGAGTATCGTCGTCAACATCCACAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020012
VALIDATED
RNF14 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020012.1-1674s1c1
Sequence:CCGGCGTGGATATTAATGGTGATATCTCGAGATATCACCATTAATATCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020012.1-340s1c1
Sequence:CCGGGCGAGTATTTATGATGTGGATCTCGAGATCCACATCATAAATACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020012.1-1559s1c1
Sequence:CCGGGCACTGGCTGTATGCAGTATTCTCGAGAATACTGCATACAGCCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020012.1-502s1c1
Sequence:CCGGCCACCACTTGTGCTGAACTTTCTCGAGAAAGTTCAGCACAAGTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020012.1-1182s1c1
Sequence:CCGGGCAGTCTACCTTGGATCTAATCTCGAGATTAGATCCAAGGTAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020012
VALIDATED
RNF14 MISSION shRNA shRNA Plasmid DNA
ring finger protein 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020012.1-1674s1c1
Sequence:CCGGCGTGGATATTAATGGTGATATCTCGAGATATCACCATTAATATCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020012.1-340s1c1
Sequence:CCGGGCGAGTATTTATGATGTGGATCTCGAGATCCACATCATAAATACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020012.1-1559s1c1
Sequence:CCGGGCACTGGCTGTATGCAGTATTCTCGAGAATACTGCATACAGCCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020012.1-502s1c1
Sequence:CCGGCCACCACTTGTGCTGAACTTTCTCGAGAAAGTTCAGCACAAGTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020012.1-1182s1c1
Sequence:CCGGGCAGTCTACCTTGGATCTAATCTCGAGATTAGATCCAAGGTAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020012
VALIDATED
RNF14 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020012.1-1674s1c1
Sequence:CCGGCGTGGATATTAATGGTGATATCTCGAGATATCACCATTAATATCCACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000037356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020012.1-340s1c1
Sequence:CCGGGCGAGTATTTATGATGTGGATCTCGAGATCCACATCATAAATACTCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000037357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020012.1-1559s1c1
Sequence:CCGGGCACTGGCTGTATGCAGTATTCTCGAGAATACTGCATACAGCCAGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000037358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020012.1-502s1c1
Sequence:CCGGCCACCACTTGTGCTGAACTTTCTCGAGAAAGTTCAGCACAAGTGGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000037355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020012.1-1182s1c1
Sequence:CCGGGCAGTCTACCTTGGATCTAATCTCGAGATTAGATCCAAGGTAGACTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???