EMAIL THIS PAGE TO A FRIEND

RNF168

ring finger protein 168, E3 ubiquitin protein ligase

77 Gene Product Result for
Synonyms: hRNF168
UniProtKB ID: Q8IYW5, Q8NA67, Q96NS4
Gene ID:
Human(165918) Summary: This gene encodes an E3 ubiquitin ligase protein that contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-DNA and protein-protein interactions. The protein is involved in DNA double-strand break (DSB) repair. Mutations in this gene result in Riddle syndrome. [provided by RefSeq, Sep 2011]
Mouse(70238) ring finger protein 168
Rat(690043) ring finger protein 168, E3 ubiquitin protein ligase
Zebrafish(334081) ring finger protein 168
chicken(770166) ring finger protein 168, E3 ubiquitin protein ligase
dog(488029) ring finger protein 168, E3 ubiquitin protein ligase
domestic cat(101086920) ring finger protein 168, E3 ubiquitin protein ligase
Horse(100069836) ring finger protein 168, E3 ubiquitin protein ligase
domestic guinea pig(100723206) ring finger protein 168, E3 ubiquitin protein ligase
naked mole-rat(101708108) ring finger protein 168, E3 ubiquitin protein ligase
cow(613812) ring finger protein 168, E3 ubiquitin protein ligase
sheep(101121991) ring finger protein 168, E3 ubiquitin protein ligase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152617 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152617 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152617 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027355 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027355 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027355 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU011891 MISSION® esiRNA esiRNA targeting human RNF168 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152617 Rosetta Predictions human pricing
NM_001127597 Rosetta Predictions rat pricing
XR_006773 Rosetta Predictions rat pricing
NM_027355 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152617 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243100 predicted 1070
2 SASI_Hs01_00243101 predicted 1538
3 SASI_Hs01_00243103 predicted 1285
4 SASI_Hs02_00366474 predicted 2046
5 SASI_Hs01_00243105 predicted 1343
6 SASI_Hs01_00243106 predicted 1823
7 SASI_Hs01_00243107 predicted 673
8 SASI_Hs01_00243109 predicted 1948
9 SASI_Hs02_00366475 predicted 1196
10 SASI_Hs02_00366476 predicted 1557
11 SASI_Hs01_00243102 predicted 1209
12 SASI_Hs01_00243104 predicted 1569
13 SASI_Hs01_00243108 predicted 1218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127597 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254580 predicted 1574
2 SASI_Rn02_00254581 predicted 978
3 SASI_Rn02_00254582 predicted 681
4 SASI_Rn02_00254583 predicted 1624
5 SASI_Rn02_00254584 predicted 1134
6 SASI_Rn02_00254585 predicted 1746
7 SASI_Rn02_00254586 predicted 1352
8 SASI_Rn02_00254587 predicted 589
9 SASI_Rn02_00254588 predicted 503
10 SASI_Rn02_00254589 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_006773 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00180830 predicted 2629
2 SASI_Rn01_00180831 predicted 1828
3 SASI_Rn01_00180832 predicted 1241
4 SASI_Rn01_00180833 predicted 940
5 SASI_Rn01_00180834 predicted 2486
6 SASI_Rn01_00180835 predicted 1882
7 SASI_Rn01_00180836 predicted 2557
8 SASI_Rn01_00180837 predicted 1395
9 SASI_Rn01_00180838 predicted 2002
10 SASI_Rn01_00180839 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027355 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332020 predicted 2249
2 SASI_Mm02_00332021 predicted 1767
3 SASI_Mm02_00332022 predicted 2193
4 SASI_Mm02_00332023 predicted 2222
5 SASI_Mm02_00332024 predicted 1383
6 SASI_Mm02_00332025 predicted 1667
7 SASI_Mm02_00332026 predicted 2289
8 SASI_Mm02_00332027 predicted 2263
9 SASI_Mm02_00332028 predicted 1592
10 SASI_Mm02_00332029 predicted 681
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152617
VALIDATED
RNF168 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 168, E3 ubiquitin protein ligase
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152617.2-1520s21c1
Sequence:CCGGTTAAGTCACGAGCGACCTAAACTCGAGTTTAGGTCGCTCGTGACTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152617.2-1864s21c1
Sequence:CCGGAGAAGAACAGGACAGGTTATTCTCGAGAATAACCTGTCCTGTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152617.2-1667s21c1
Sequence:CCGGTCGTGCCTACTGATCAGTAAGCTCGAGCTTACTGATCAGTAGGCACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152617.2-1215s21c1
Sequence:CCGGAGAAGTATTTGACACCGAAATCTCGAGATTTCGGTGTCAAATACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152617.2-757s1c1
Sequence:CCGGCGTGGAACTGTGGACGATAATCTCGAGATTATCGTCCACAGTTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152617.2-2122s1c1
Sequence:CCGGGCAGTCAGTTAATAGAAGAAACTCGAGTTTCTTCTATTAACTGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152617.2-736s1c1
Sequence:CCGGCCGAAGAAATTCTCTCGTCAACTCGAGTTGACGAGAGAATTTCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152617.2-1362s1c1
Sequence:CCGGCGACACTTTCTCCACAGATATCTCGAGATATCTGTGGAGAAAGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152617.2-1982s1c1
Sequence:CCGGCCTCCAGACAAAGTGCTAAATCTCGAGATTTAGCACTTTGTCTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152617.2-758s21c1
Sequence:CCGGGTGGAACTGTGGACGATAATTCTCGAGAATTATCGTCCACAGTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152617.2-2190s21c1
Sequence:CCGGACTCCCTACAGCCTAGCATTTCTCGAGAAATGCTAGGCTGTAGGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152617
VALIDATED
RNF168 MISSION shRNA shRNA Plasmid DNA
ring finger protein 168, E3 ubiquitin protein ligase
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152617.2-1520s21c1
Sequence:CCGGTTAAGTCACGAGCGACCTAAACTCGAGTTTAGGTCGCTCGTGACTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152617.2-1864s21c1
Sequence:CCGGAGAAGAACAGGACAGGTTATTCTCGAGAATAACCTGTCCTGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152617.2-1667s21c1
Sequence:CCGGTCGTGCCTACTGATCAGTAAGCTCGAGCTTACTGATCAGTAGGCACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152617.2-1215s21c1
Sequence:CCGGAGAAGTATTTGACACCGAAATCTCGAGATTTCGGTGTCAAATACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152617.2-757s1c1
Sequence:CCGGCGTGGAACTGTGGACGATAATCTCGAGATTATCGTCCACAGTTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152617.2-2122s1c1
Sequence:CCGGGCAGTCAGTTAATAGAAGAAACTCGAGTTTCTTCTATTAACTGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152617.2-736s1c1
Sequence:CCGGCCGAAGAAATTCTCTCGTCAACTCGAGTTGACGAGAGAATTTCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152617.2-1362s1c1
Sequence:CCGGCGACACTTTCTCCACAGATATCTCGAGATATCTGTGGAGAAAGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152617.2-1982s1c1
Sequence:CCGGCCTCCAGACAAAGTGCTAAATCTCGAGATTTAGCACTTTGTCTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152617.2-758s21c1
Sequence:CCGGGTGGAACTGTGGACGATAATTCTCGAGAATTATCGTCCACAGTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152617.2-2190s21c1
Sequence:CCGGACTCCCTACAGCCTAGCATTTCTCGAGAAATGCTAGGCTGTAGGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152617
VALIDATED
RNF168 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 168, E3 ubiquitin protein ligase
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152617.2-1520s21c1
Sequence:CCGGTTAAGTCACGAGCGACCTAAACTCGAGTTTAGGTCGCTCGTGACTTAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152617.2-1864s21c1
Sequence:CCGGAGAAGAACAGGACAGGTTATTCTCGAGAATAACCTGTCCTGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152617.2-1667s21c1
Sequence:CCGGTCGTGCCTACTGATCAGTAAGCTCGAGCTTACTGATCAGTAGGCACGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152617.2-1215s21c1
Sequence:CCGGAGAAGTATTTGACACCGAAATCTCGAGATTTCGGTGTCAAATACTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152617.2-757s1c1
Sequence:CCGGCGTGGAACTGTGGACGATAATCTCGAGATTATCGTCCACAGTTCCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152617.2-2122s1c1
Sequence:CCGGGCAGTCAGTTAATAGAAGAAACTCGAGTTTCTTCTATTAACTGACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152617.2-736s1c1
Sequence:CCGGCCGAAGAAATTCTCTCGTCAACTCGAGTTGACGAGAGAATTTCTTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152617.2-1362s1c1
Sequence:CCGGCGACACTTTCTCCACAGATATCTCGAGATATCTGTGGAGAAAGTGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152617.2-1982s1c1
Sequence:CCGGCCTCCAGACAAAGTGCTAAATCTCGAGATTTAGCACTTTGTCTGGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152617.2-758s21c1
Sequence:CCGGGTGGAACTGTGGACGATAATTCTCGAGAATTATCGTCCACAGTTCCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152617.2-2190s21c1
Sequence:CCGGACTCCCTACAGCCTAGCATTTCTCGAGAAATGCTAGGCTGTAGGGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027355
VALIDATED
RNF168 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 168, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027355.1-2225s1c1
Sequence:CCGGGCCAACTTCTACTCAAGATAACTCGAGTTATCTTGAGTAGAAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027355.1-824s1c1
Sequence:CCGGCCGAAGAAATTCTCTGGTCAACTCGAGTTGACCAGAGAATTTCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027355.1-1955s1c1
Sequence:CCGGGCAGGACAGATTGTTAGCATTCTCGAGAATGCTAACAATCTGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027355.1-904s1c1
Sequence:CCGGCTGGACAAGAATCAAAGGAAACTCGAGTTTCCTTTGATTCTTGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027355.1-1207s1c1
Sequence:CCGGCCTTGGCTTCTCCTTTGAGTTCTCGAGAACTCAAAGGAGAAGCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027355
VALIDATED
RNF168 MISSION shRNA shRNA Plasmid DNA
ring finger protein 168, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027355.1-2225s1c1
Sequence:CCGGGCCAACTTCTACTCAAGATAACTCGAGTTATCTTGAGTAGAAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027355.1-824s1c1
Sequence:CCGGCCGAAGAAATTCTCTGGTCAACTCGAGTTGACCAGAGAATTTCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027355.1-1955s1c1
Sequence:CCGGGCAGGACAGATTGTTAGCATTCTCGAGAATGCTAACAATCTGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027355.1-904s1c1
Sequence:CCGGCTGGACAAGAATCAAAGGAAACTCGAGTTTCCTTTGATTCTTGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027355.1-1207s1c1
Sequence:CCGGCCTTGGCTTCTCCTTTGAGTTCTCGAGAACTCAAAGGAGAAGCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027355
VALIDATED
RNF168 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 168, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027355.1-2225s1c1
Sequence:CCGGGCCAACTTCTACTCAAGATAACTCGAGTTATCTTGAGTAGAAGTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027355.1-824s1c1
Sequence:CCGGCCGAAGAAATTCTCTGGTCAACTCGAGTTGACCAGAGAATTTCTTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027355.1-1955s1c1
Sequence:CCGGGCAGGACAGATTGTTAGCATTCTCGAGAATGCTAACAATCTGTCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027355.1-904s1c1
Sequence:CCGGCTGGACAAGAATCAAAGGAAACTCGAGTTTCCTTTGATTCTTGTCCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027355.1-1207s1c1
Sequence:CCGGCCTTGGCTTCTCCTTTGAGTTCTCGAGAACTCAAAGGAGAAGCCAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)