EMAIL THIS PAGE TO A FRIEND

RNF19B

ring finger protein 19B

118 Gene Product Result for
Synonyms: IBRDC3 NKLAM
Gene ID:
Human(127544) Summary: IBRDC3 is a cytolysis-associated transmembrane protein expressed in natural killer (NK) cells and T lymphocytes following cytokine stimulation (Kozlowski et al., 1999 [PubMed 10438909]
Mouse(75234) ring finger protein 19B
Rat(313806) ring finger protein 19B
cow(509774) ring finger protein 19B
sheep(101104466) ring finger protein 19B
naked mole-rat(101697249) ring finger protein 19B
Domestic Rabbit(100339939) ring finger protein 19B
domestic guinea pig(100726294) ring finger protein 19B
Zebrafish(562396) ring finger protein 19B
chicken(419669) ring finger protein 19B
Horse(100070073) ring finger protein 19B
domestic cat(101083280) ring finger protein 19B
dog(478146) ring finger protein 19B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA049587 Anti-RNF19B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153341 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153341 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153341 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029219 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029219 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029219 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_204030 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_204030 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_204030 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127361 Rosetta Predictions human pricing
NM_153341 Rosetta Predictions human pricing
NM_001108003 Rosetta Predictions rat pricing
XM_204030 Rosetta Predictions mouse pricing
XM_910375 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329214 predicted 1110
2 SASI_Hs02_00329215 predicted 1487
3 SASI_Hs02_00329216 predicted 1189
4 SASI_Hs02_00329217 predicted 2049
5 SASI_Hs02_00329218 predicted 1445
6 SASI_Hs02_00329219 predicted 1460
7 SASI_Hs02_00329220 predicted 1134
8 SASI_Hs02_00329221 predicted 1299
9 SASI_Hs02_00329222 predicted 1105
10 SASI_Hs02_00329223 predicted 1167
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367195 predicted 1112
2 SASI_Hs02_00367196 predicted 1490
3 SASI_Hs01_00042283 predicted 1197
4 SASI_Hs01_00042284 predicted 1995
5 SASI_Hs01_00042285 predicted 1448
6 SASI_Hs01_00042288 predicted 1457
7 SASI_Hs01_00042289 predicted 1141
8 SASI_Hs02_00367197 predicted 1300
9 SASI_Hs02_00367198 predicted 1115
10 SASI_Hs02_00367199 predicted 1175
11 SASI_Hs01_00042282 predicted 256
12 SASI_Hs01_00042286 predicted 364
13 SASI_Hs01_00042287 predicted 1123
14 SASI_Hs01_00042290 predicted 1094
15 SASI_Hs01_00042291 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108003 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234405 predicted 826
2 SASI_Rn02_00234406 predicted 461
3 SASI_Rn02_00234407 predicted 418
4 SASI_Rn02_00234408 predicted 356
5 SASI_Rn02_00234409 predicted 778
6 SASI_Rn02_00234410 predicted 954
7 SASI_Rn02_00234411 predicted 321
8 SASI_Rn02_00234412 predicted 927
9 SASI_Rn02_00234413 predicted 796
10 SASI_Rn02_00234414 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_204030 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425526 predicted 1915
2 SASI_Mm01_00206670 predicted 1906
3 SASI_Mm01_00206671 predicted 1807
4 SASI_Mm02_00425527 predicted 2429
5 SASI_Mm01_00206672 predicted 1715
6 SASI_Mm02_00425528 predicted 1033
7 SASI_Mm01_00206677 predicted 1818
8 SASI_Mm01_00206678 predicted 2250
9 SASI_Mm01_00206679 predicted 1783
10 SASI_Mm02_00425529 predicted 1965
11 SASI_Mm01_00206673 predicted 1123
12 SASI_Mm01_00206674 predicted 1981
13 SASI_Mm01_00206675 predicted 1357
14 SASI_Mm01_00206676 predicted 1414
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_910375 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00435505 predicted 1736
2 SASI_Mm02_00435506 predicted 1725
3 SASI_Mm02_00435507 predicted 1630
4 SASI_Mm02_00435508 predicted 2257
5 SASI_Mm02_00435509 predicted 1541
6 SASI_Mm02_00435510 predicted 861
7 SASI_Mm02_00435511 predicted 1640
8 SASI_Mm02_00435512 predicted 2077
9 SASI_Mm02_00435513 predicted 1611
10 SASI_Mm02_00435514 predicted 1793
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153341
RNF19B MISSION shRNA Bacterial Glycerol Stock
ring finger protein 19B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153341.1-1579s1c1
Sequence:CCGGCGAGGGACAAACTGTCTTGAACTCGAGTTCAAGACAGTTTGTCCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153341.1-704s1c1
Sequence:CCGGCCCATTATGCTGGCATATGTTCTCGAGAACATATGCCAGCATAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153341.1-1138s1c1
Sequence:CCGGCGGTTCCATAATCAGTTCCTACTCGAGTAGGAACTGATTATGGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153341.1-150s1c1
Sequence:CCGGGCAAGCAGATATGGCATCCAACTCGAGTTGGATGCCATATCTGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153341.2-865s21c1
Sequence:CCGGCGATGCAGTGCATACATTATCCTCGAGGATAATGTATGCACTGCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153341.2-1660s21c1
Sequence:CCGGACAGCCAGTCTTGGTGCAATTCTCGAGAATTGCACCAAGACTGGCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153341.2-1214s21c1
Sequence:CCGGGAGTGACTTTGTCGGTCATTGCTCGAGCAATGACCGACAAAGTCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153341.2-628s21c1
Sequence:CCGGGACTGCGGTTATGCTGTTATTCTCGAGAATAACAGCATAACCGCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153341
RNF19B MISSION shRNA shRNA Plasmid DNA
ring finger protein 19B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153341.1-1579s1c1
Sequence:CCGGCGAGGGACAAACTGTCTTGAACTCGAGTTCAAGACAGTTTGTCCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153341.1-704s1c1
Sequence:CCGGCCCATTATGCTGGCATATGTTCTCGAGAACATATGCCAGCATAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153341.1-1138s1c1
Sequence:CCGGCGGTTCCATAATCAGTTCCTACTCGAGTAGGAACTGATTATGGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153341.1-150s1c1
Sequence:CCGGGCAAGCAGATATGGCATCCAACTCGAGTTGGATGCCATATCTGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153341.2-865s21c1
Sequence:CCGGCGATGCAGTGCATACATTATCCTCGAGGATAATGTATGCACTGCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153341.2-1660s21c1
Sequence:CCGGACAGCCAGTCTTGGTGCAATTCTCGAGAATTGCACCAAGACTGGCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153341.2-1214s21c1
Sequence:CCGGGAGTGACTTTGTCGGTCATTGCTCGAGCAATGACCGACAAAGTCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153341.2-628s21c1
Sequence:CCGGGACTGCGGTTATGCTGTTATTCTCGAGAATAACAGCATAACCGCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153341
RNF19B MISSION shRNA Lentiviral Transduction Particles
ring finger protein 19B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153341.1-1579s1c1
Sequence:CCGGCGAGGGACAAACTGTCTTGAACTCGAGTTCAAGACAGTTTGTCCCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153341.1-704s1c1
Sequence:CCGGCCCATTATGCTGGCATATGTTCTCGAGAACATATGCCAGCATAATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153341.1-1138s1c1
Sequence:CCGGCGGTTCCATAATCAGTTCCTACTCGAGTAGGAACTGATTATGGAACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153341.1-150s1c1
Sequence:CCGGGCAAGCAGATATGGCATCCAACTCGAGTTGGATGCCATATCTGCTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153341.2-865s21c1
Sequence:CCGGCGATGCAGTGCATACATTATCCTCGAGGATAATGTATGCACTGCATCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153341.2-1660s21c1
Sequence:CCGGACAGCCAGTCTTGGTGCAATTCTCGAGAATTGCACCAAGACTGGCTGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153341.2-1214s21c1
Sequence:CCGGGAGTGACTTTGTCGGTCATTGCTCGAGCAATGACCGACAAAGTCACTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153341.2-628s21c1
Sequence:CCGGGACTGCGGTTATGCTGTTATTCTCGAGAATAACAGCATAACCGCAGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029219
RNF19B MISSION shRNA Bacterial Glycerol Stock
ring finger protein 19B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000334121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029219.1-704s21c1
Sequence:CCGGGCTACCACTGCAAGCAGATATCTCGAGATATCTGCTTGCAGTGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029219.1-1237s21c1
Sequence:CCGGGCTGCTGTTAGCGTTGGTATTCTCGAGAATACCAACGCTAACAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029219.1-1173s21c1
Sequence:CCGGGCACAAGAGGAATTTGGCTATCTCGAGATAGCCAAATTCCTCTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029219.1-2174s21c1
Sequence:CCGGCAGAAGAGTATGAAGTGGAATCTCGAGATTCCACTTCATACTCTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029219
RNF19B MISSION shRNA shRNA Plasmid DNA
ring finger protein 19B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000334121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029219.1-704s21c1
Sequence:CCGGGCTACCACTGCAAGCAGATATCTCGAGATATCTGCTTGCAGTGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029219.1-1237s21c1
Sequence:CCGGGCTGCTGTTAGCGTTGGTATTCTCGAGAATACCAACGCTAACAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029219.1-1173s21c1
Sequence:CCGGGCACAAGAGGAATTTGGCTATCTCGAGATAGCCAAATTCCTCTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029219.1-2174s21c1
Sequence:CCGGCAGAAGAGTATGAAGTGGAATCTCGAGATTCCACTTCATACTCTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029219
RNF19B MISSION shRNA Lentiviral Transduction Particles
ring finger protein 19B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000334121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029219.1-704s21c1
Sequence:CCGGGCTACCACTGCAAGCAGATATCTCGAGATATCTGCTTGCAGTGGTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029219.1-1237s21c1
Sequence:CCGGGCTGCTGTTAGCGTTGGTATTCTCGAGAATACCAACGCTAACAGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029219.1-1173s21c1
Sequence:CCGGGCACAAGAGGAATTTGGCTATCTCGAGATAGCCAAATTCCTCTTGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029219.1-2174s21c1
Sequence:CCGGCAGAAGAGTATGAAGTGGAATCTCGAGATTCCACTTCATACTCTTCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_204030
RNF19B MISSION shRNA Bacterial Glycerol Stock
ring finger protein 19B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_204030.3-508s1c1
Sequence:CCGGGCTACCACTGCAAGCAGATATCTCGAGATATCTGCTTGCAGTGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_204030.3-2130s1c1
Sequence:CCGGCCTTGCATATTGGAACAGGAACTCGAGTTCCTGTTCCAATATGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_204030.3-1981s1c1
Sequence:CCGGCAGAAGAGTATGAAGTGGAATCTCGAGATTCCACTTCATACTCTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_204030.3-980s1c1
Sequence:CCGGGCACAAGAGGAATTTGGCTATCTCGAGATAGCCAAATTCCTCTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_204030.3-1044s1c1
Sequence:CCGGGCTGCTGTTAGCGTTGGTATTCTCGAGAATACCAACGCTAACAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_204030
RNF19B MISSION shRNA shRNA Plasmid DNA
ring finger protein 19B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_204030.3-508s1c1
Sequence:CCGGGCTACCACTGCAAGCAGATATCTCGAGATATCTGCTTGCAGTGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_204030.3-2130s1c1
Sequence:CCGGCCTTGCATATTGGAACAGGAACTCGAGTTCCTGTTCCAATATGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_204030.3-1981s1c1
Sequence:CCGGCAGAAGAGTATGAAGTGGAATCTCGAGATTCCACTTCATACTCTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_204030.3-980s1c1
Sequence:CCGGGCACAAGAGGAATTTGGCTATCTCGAGATAGCCAAATTCCTCTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_204030.3-1044s1c1
Sequence:CCGGGCTGCTGTTAGCGTTGGTATTCTCGAGAATACCAACGCTAACAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_204030
RNF19B MISSION shRNA Lentiviral Transduction Particles
ring finger protein 19B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_204030.3-508s1c1
Sequence:CCGGGCTACCACTGCAAGCAGATATCTCGAGATATCTGCTTGCAGTGGTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_204030.3-2130s1c1
Sequence:CCGGCCTTGCATATTGGAACAGGAACTCGAGTTCCTGTTCCAATATGCAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_204030.3-1981s1c1
Sequence:CCGGCAGAAGAGTATGAAGTGGAATCTCGAGATTCCACTTCATACTCTTCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_204030.3-980s1c1
Sequence:CCGGGCACAAGAGGAATTTGGCTATCTCGAGATAGCCAAATTCCTCTTGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_204030.3-1044s1c1
Sequence:CCGGGCTGCTGTTAGCGTTGGTATTCTCGAGAATACCAACGCTAACAGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)