EMAIL THIS PAGE TO A FRIEND

RNF20

ring finger protein 20, E3 ubiquitin protein ligase

123 Gene Product Result for
Synonyms: BRE1 BRE1A hBRE1
Gene ID:
Human(56254) Summary: The protein encoded by this gene shares similarity with BRE1 of S. cerevisiae. The protein encoded by this human gene is an E3 ubiquitin ligase that regulates chromosome structure by monoubiquitinating histone H2B. This protein acts as a putative tumor suppressor and positively regulates the p53 tumor suppressor as well as numerous histone H2A and H2B genes. In contrast, this protein also suppresses the expression of several protooncogenes and growth-related genes, including many genes that are induced by epidermal growth factor. This gene selectively suppresses the expression of some genes by interfering with chromatin recruitment of transcription elongation factor SII (TFIIS). [provided by RefSeq, Feb 2012]
Mouse(109331) ring finger protein 20
Rat(313216) ring finger protein 20, E3 ubiquitin protein ligase
cow(513326) ring finger protein 20
sheep(101121065) ring finger protein 20, E3 ubiquitin protein ligase
naked mole-rat(101711656) ring finger protein 20, E3 ubiquitin protein ligase
Domestic Rabbit(100340973) ring finger protein 20, E3 ubiquitin protein ligase
domestic guinea pig(100717191) ring finger protein 20, E3 ubiquitin protein ligase
Zebrafish(402838) ring finger protein 20, E3 ubiquitin protein ligase
domestic cat(101097522) ring finger protein 20, E3 ubiquitin protein ligase
Horse(100054384) ring finger protein 20, E3 ubiquitin protein ligase
dog(474788) ring finger protein 20, E3 ubiquitin protein ligase
chicken(427310) ring finger protein 20, E3 ubiquitin protein ligase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019592 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019592 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019592 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_182999 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_182999 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_182999 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036561 MISSION® esiRNA esiRNA human RNF20 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019592 Rosetta Predictions human pricing
NM_001107929 Rosetta Predictions rat pricing
NM_182999 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019592 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163574 predicted 2354
2 SASI_Hs01_00163575 predicted 2388
3 SASI_Hs01_00163576 predicted 793
4 SASI_Hs01_00163577 predicted 2617
5 SASI_Hs01_00163578 predicted 701
6 SASI_Hs01_00163579 predicted 336
7 SASI_Hs01_00163580 predicted 2999
8 SASI_Hs01_00163581 predicted 1019
9 SASI_Hs01_00163582 predicted 2948
10 SASI_Hs01_00163583 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107929 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233675 predicted 3309
2 SASI_Rn02_00233676 predicted 1281
3 SASI_Rn02_00233677 predicted 1040
4 SASI_Rn02_00233678 predicted 2802
5 SASI_Rn02_00233679 predicted 1352
6 SASI_Rn02_00233680 predicted 1770
7 SASI_Rn02_00233681 predicted 974
8 SASI_Rn02_00233682 predicted 1369
9 SASI_Rn02_00233683 predicted 1549
10 SASI_Rn02_00233684 predicted 2715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182999 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196995 predicted 3156
2 SASI_Mm01_00196997 predicted 572
3 SASI_Mm02_00350007 predicted 1617
4 SASI_Mm01_00196998 predicted 2568
5 SASI_Mm01_00196999 predicted 826
6 SASI_Mm01_00197000 predicted 1220
7 SASI_Mm01_00197001 predicted 1402
8 SASI_Mm01_00197002 predicted 1196
9 SASI_Mm01_00197003 predicted 1008
10 SASI_Mm02_00350008 predicted 2969
11 SASI_Mm01_00196996 predicted 2651
12 SASI_Mm01_00197004 predicted 1575
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019592
VALIDATED
RNF20 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 20, E3 ubiquitin protein ligase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019592.5-2857s1c1
Sequence:CCGGCCGTGCTGTAACATGCGTAAACTCGAGTTTACGCATGTTACAGCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019592.5-341s1c1
Sequence:CCGGCCACTGATGATGCCTCACTATCTCGAGATAGTGAGGCATCATCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019592.5-1759s1c1
Sequence:CCGGGCCAATGAAATCAAGTCTAAACTCGAGTTTAGACTTGATTTCATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_019592.5-218s1c1
Sequence:CCGGCGGAGGAACTAGACATTAGAACTCGAGTTCTAATGTCTAGTTCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019592.5-1488s21c1
Sequence:CCGGTGAACAAGCAGGCCCTATAAACTCGAGTTTATAGGGCCTGCTTGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019592.5-947s21c1
Sequence:CCGGAGCGACTCAACCGACACTTAGCTCGAGCTAAGTGTCGGTTGAGTCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019592.5-499s21c1
Sequence:CCGGGATAGCAATCAGGAGCGTAAACTCGAGTTTACGCTCCTGATTGCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019592.5-403s21c1
Sequence:CCGGCGTATCATCCTTAAACGTTATCTCGAGATAACGTTTAAGGATGATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019592
VALIDATED
RNF20 MISSION shRNA shRNA Plasmid DNA
ring finger protein 20, E3 ubiquitin protein ligase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019592.5-2857s1c1
Sequence:CCGGCCGTGCTGTAACATGCGTAAACTCGAGTTTACGCATGTTACAGCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019592.5-341s1c1
Sequence:CCGGCCACTGATGATGCCTCACTATCTCGAGATAGTGAGGCATCATCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019592.5-1759s1c1
Sequence:CCGGGCCAATGAAATCAAGTCTAAACTCGAGTTTAGACTTGATTTCATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_019592.5-218s1c1
Sequence:CCGGCGGAGGAACTAGACATTAGAACTCGAGTTCTAATGTCTAGTTCCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019592.5-1488s21c1
Sequence:CCGGTGAACAAGCAGGCCCTATAAACTCGAGTTTATAGGGCCTGCTTGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019592.5-947s21c1
Sequence:CCGGAGCGACTCAACCGACACTTAGCTCGAGCTAAGTGTCGGTTGAGTCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019592.5-499s21c1
Sequence:CCGGGATAGCAATCAGGAGCGTAAACTCGAGTTTACGCTCCTGATTGCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019592.5-403s21c1
Sequence:CCGGCGTATCATCCTTAAACGTTATCTCGAGATAACGTTTAAGGATGATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019592
VALIDATED
RNF20 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 20, E3 ubiquitin protein ligase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019592.5-2857s1c1
Sequence:CCGGCCGTGCTGTAACATGCGTAAACTCGAGTTTACGCATGTTACAGCACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019592.5-341s1c1
Sequence:CCGGCCACTGATGATGCCTCACTATCTCGAGATAGTGAGGCATCATCAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019592.5-1759s1c1
Sequence:CCGGGCCAATGAAATCAAGTCTAAACTCGAGTTTAGACTTGATTTCATTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_019592.5-218s1c1
Sequence:CCGGCGGAGGAACTAGACATTAGAACTCGAGTTCTAATGTCTAGTTCCTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019592.5-1488s21c1
Sequence:CCGGTGAACAAGCAGGCCCTATAAACTCGAGTTTATAGGGCCTGCTTGTTCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019592.5-947s21c1
Sequence:CCGGAGCGACTCAACCGACACTTAGCTCGAGCTAAGTGTCGGTTGAGTCGCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019592.5-499s21c1
Sequence:CCGGGATAGCAATCAGGAGCGTAAACTCGAGTTTACGCTCCTGATTGCTATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019592.5-403s21c1
Sequence:CCGGCGTATCATCCTTAAACGTTATCTCGAGATAACGTTTAAGGATGATACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182999
VALIDATED
RNF20 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 20, E3 ubiquitin protein ligase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182999.1-3028s1c1
Sequence:CCGGCCTTGCTGTAACATGCGTAAACTCGAGTTTACGCATGTTACAGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182999.1-580s1c1
Sequence:CCGGCGCATCATCCTTAAACGTTATCTCGAGATAACGTTTAAGGATGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182999.1-2559s1c1
Sequence:CCGGGCGAATCAAGTCTAATCAGATCTCGAGATCTGATTAGACTTGATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182999.1-2821s1c1
Sequence:CCGGGCTCAGAAGAAGCTCCATGATCTCGAGATCATGGAGCTTCTTCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182999.1-1234s1c1
Sequence:CCGGCGGAAGTTTGAGGAAATGAATCTCGAGATTCATTTCCTCAAACTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182999.1-2821s21c1
Sequence:CCGGGCTCAGAAGAAGCTCCATGATCTCGAGATCATGGAGCTTCTTCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182999.1-3028s21c1
Sequence:CCGGCCTTGCTGTAACATGCGTAAACTCGAGTTTACGCATGTTACAGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182999.1-1234s21c1
Sequence:CCGGCGGAAGTTTGAGGAAATGAATCTCGAGATTCATTTCCTCAAACTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182999.1-2559s21c1
Sequence:CCGGGCGAATCAAGTCTAATCAGATCTCGAGATCTGATTAGACTTGATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182999.1-580s21c1
Sequence:CCGGCGCATCATCCTTAAACGTTATCTCGAGATAACGTTTAAGGATGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182999
VALIDATED
RNF20 MISSION shRNA shRNA Plasmid DNA
ring finger protein 20, E3 ubiquitin protein ligase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182999.1-3028s1c1
Sequence:CCGGCCTTGCTGTAACATGCGTAAACTCGAGTTTACGCATGTTACAGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182999.1-580s1c1
Sequence:CCGGCGCATCATCCTTAAACGTTATCTCGAGATAACGTTTAAGGATGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182999.1-2559s1c1
Sequence:CCGGGCGAATCAAGTCTAATCAGATCTCGAGATCTGATTAGACTTGATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182999.1-2821s1c1
Sequence:CCGGGCTCAGAAGAAGCTCCATGATCTCGAGATCATGGAGCTTCTTCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182999.1-1234s1c1
Sequence:CCGGCGGAAGTTTGAGGAAATGAATCTCGAGATTCATTTCCTCAAACTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182999.1-2821s21c1
Sequence:CCGGGCTCAGAAGAAGCTCCATGATCTCGAGATCATGGAGCTTCTTCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182999.1-3028s21c1
Sequence:CCGGCCTTGCTGTAACATGCGTAAACTCGAGTTTACGCATGTTACAGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182999.1-1234s21c1
Sequence:CCGGCGGAAGTTTGAGGAAATGAATCTCGAGATTCATTTCCTCAAACTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182999.1-2559s21c1
Sequence:CCGGGCGAATCAAGTCTAATCAGATCTCGAGATCTGATTAGACTTGATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182999.1-580s21c1
Sequence:CCGGCGCATCATCCTTAAACGTTATCTCGAGATAACGTTTAAGGATGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182999
VALIDATED
RNF20 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 20, E3 ubiquitin protein ligase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182999.1-3028s1c1
Sequence:CCGGCCTTGCTGTAACATGCGTAAACTCGAGTTTACGCATGTTACAGCAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182999.1-580s1c1
Sequence:CCGGCGCATCATCCTTAAACGTTATCTCGAGATAACGTTTAAGGATGATGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182999.1-2559s1c1
Sequence:CCGGGCGAATCAAGTCTAATCAGATCTCGAGATCTGATTAGACTTGATTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182999.1-2821s1c1
Sequence:CCGGGCTCAGAAGAAGCTCCATGATCTCGAGATCATGGAGCTTCTTCTGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182999.1-1234s1c1
Sequence:CCGGCGGAAGTTTGAGGAAATGAATCTCGAGATTCATTTCCTCAAACTTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182999.1-2821s21c1
Sequence:CCGGGCTCAGAAGAAGCTCCATGATCTCGAGATCATGGAGCTTCTTCTGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182999.1-3028s21c1
Sequence:CCGGCCTTGCTGTAACATGCGTAAACTCGAGTTTACGCATGTTACAGCAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182999.1-1234s21c1
Sequence:CCGGCGGAAGTTTGAGGAAATGAATCTCGAGATTCATTTCCTCAAACTTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182999.1-2559s21c1
Sequence:CCGGGCGAATCAAGTCTAATCAGATCTCGAGATCTGATTAGACTTGATTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182999.1-580s21c1
Sequence:CCGGCGCATCATCCTTAAACGTTATCTCGAGATAACGTTTAAGGATGATGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)