EMAIL THIS PAGE TO A FRIEND

RNF219

ring finger protein 219

99 Gene Product Result for
Synonyms: C13orf7
UniProtKB ID: Q5W0B1, B2RN99, Q8TBY2, Q9H0T2, Q9H8M0
Gene ID:
Mouse(72486) ring finger protein 219
Rat(361088) ring finger protein 219
domestic guinea pig(100729851) ring finger protein 219
naked mole-rat(101710777) ring finger protein 219
cow(782050) ring finger protein 219
sheep(101103904) ring finger protein 219
chicken(418805) ring finger protein 219
domestic cat(101087123) ring finger protein 219
dog(476954) ring finger protein 219
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026047 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026047 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026047 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024546 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024546 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024546 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU066691 MISSION® esiRNA esiRNA human C13orf7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024546 Rosetta Predictions human pricing
NM_001108389 Rosetta Predictions rat pricing
NM_026047 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168820 predicted 549
2 SASI_Hs01_00168821 predicted 1121
3 SASI_Hs01_00168822 predicted 1870
4 SASI_Hs01_00168823 predicted 1553
5 SASI_Hs01_00168826 predicted 739
6 SASI_Hs01_00168827 predicted 1046
7 SASI_Hs01_00168828 predicted 1822
8 SASI_Hs01_00168829 predicted 845
9 SASI_Hs02_00356848 predicted 1452
10 SASI_Hs02_00356849 predicted 1202
11 SASI_Hs01_00168824 predicted 2118
12 SASI_Hs01_00168825 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108389 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238179 predicted 787
2 SASI_Rn02_00238180 predicted 1808
3 SASI_Rn02_00238181 predicted 1394
4 SASI_Rn02_00238182 predicted 440
5 SASI_Rn02_00238183 predicted 1472
6 SASI_Rn02_00238184 predicted 359
7 SASI_Rn02_00238185 predicted 592
8 SASI_Rn02_00238186 predicted 1710
9 SASI_Rn02_00238187 predicted 2089
10 SASI_Rn02_00238188 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026047 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147160 predicted 2030
2 SASI_Mm01_00147161 predicted 1474
3 SASI_Mm02_00329554 predicted 732
4 SASI_Mm01_00147162 predicted 420
5 SASI_Mm01_00147163 predicted 444
6 SASI_Mm01_00147165 predicted 338
7 SASI_Mm01_00147166 predicted 992
8 SASI_Mm02_00329555 predicted 2267
9 SASI_Mm01_00147167 predicted 1949
10 SASI_Mm01_00147168 predicted 764
11 SASI_Mm01_00147164 predicted 1446
12 SASI_Mm01_00147169 predicted 1347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026047
VALIDATED
RNF219 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 219
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026047.4-1486s21c1
Sequence:CCGGGGTTCAGAGGGAAACGCAATACTCGAGTATTGCGTTTCCCTCTGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026047.4-2012s21c1
Sequence:CCGGGCAGTTCCCAGGGATTATTTGCTCGAGCAAATAATCCCTGGGAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026047.4-1215s21c1
Sequence:CCGGCTGCACTCCCTTGTCACTTAGCTCGAGCTAAGTGACAAGGGAGTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026047.4-2041s21c1
Sequence:CCGGAGGTTTGGATCGTCCTTATTTCTCGAGAAATAAGGACGATCCAAACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026047.4-428s21c1
Sequence:CCGGAGACCATTCTGGATCCTTTAGCTCGAGCTAAAGGATCCAGAATGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026047.3-2532s1c1
Sequence:CCGGCCTGTGTTTCTTAGAACATTTCTCGAGAAATGTTCTAAGAAACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026047.3-453s1c1
Sequence:CCGGCTGGCCGATAATCCAAGTAAACTCGAGTTTACTTGGATTATCGGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026047.4-579s21c1
Sequence:CCGGAGATGATGTGGATAAGTTAAACTCGAGTTTAACTTATCCACATCATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026047.3-1555s1c1
Sequence:CCGGCCCTCGAAATGAATCGAACAACTCGAGTTGTTCGATTCATTTCGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026047.3-687s1c1
Sequence:CCGGCAGTCCAAAGTAGAACAGTATCTCGAGATACTGTTCTACTTTGGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026047.3-1865s1c1
Sequence:CCGGCCACGAGATGAGTGAAGATTTCTCGAGAAATCTTCACTCATCTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026047
VALIDATED
RNF219 MISSION shRNA shRNA Plasmid DNA
ring finger protein 219
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026047.4-1486s21c1
Sequence:CCGGGGTTCAGAGGGAAACGCAATACTCGAGTATTGCGTTTCCCTCTGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026047.4-2012s21c1
Sequence:CCGGGCAGTTCCCAGGGATTATTTGCTCGAGCAAATAATCCCTGGGAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026047.4-1215s21c1
Sequence:CCGGCTGCACTCCCTTGTCACTTAGCTCGAGCTAAGTGACAAGGGAGTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026047.4-2041s21c1
Sequence:CCGGAGGTTTGGATCGTCCTTATTTCTCGAGAAATAAGGACGATCCAAACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026047.4-428s21c1
Sequence:CCGGAGACCATTCTGGATCCTTTAGCTCGAGCTAAAGGATCCAGAATGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026047.3-2532s1c1
Sequence:CCGGCCTGTGTTTCTTAGAACATTTCTCGAGAAATGTTCTAAGAAACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026047.3-453s1c1
Sequence:CCGGCTGGCCGATAATCCAAGTAAACTCGAGTTTACTTGGATTATCGGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026047.4-579s21c1
Sequence:CCGGAGATGATGTGGATAAGTTAAACTCGAGTTTAACTTATCCACATCATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026047.3-1555s1c1
Sequence:CCGGCCCTCGAAATGAATCGAACAACTCGAGTTGTTCGATTCATTTCGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026047.3-687s1c1
Sequence:CCGGCAGTCCAAAGTAGAACAGTATCTCGAGATACTGTTCTACTTTGGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026047.3-1865s1c1
Sequence:CCGGCCACGAGATGAGTGAAGATTTCTCGAGAAATCTTCACTCATCTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026047
VALIDATED
RNF219 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 219
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026047.4-1486s21c1
Sequence:CCGGGGTTCAGAGGGAAACGCAATACTCGAGTATTGCGTTTCCCTCTGAACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026047.4-2012s21c1
Sequence:CCGGGCAGTTCCCAGGGATTATTTGCTCGAGCAAATAATCCCTGGGAACTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026047.4-1215s21c1
Sequence:CCGGCTGCACTCCCTTGTCACTTAGCTCGAGCTAAGTGACAAGGGAGTGCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026047.4-2041s21c1
Sequence:CCGGAGGTTTGGATCGTCCTTATTTCTCGAGAAATAAGGACGATCCAAACCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026047.4-428s21c1
Sequence:CCGGAGACCATTCTGGATCCTTTAGCTCGAGCTAAAGGATCCAGAATGGTCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026047.3-2532s1c1
Sequence:CCGGCCTGTGTTTCTTAGAACATTTCTCGAGAAATGTTCTAAGAAACACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026047.3-453s1c1
Sequence:CCGGCTGGCCGATAATCCAAGTAAACTCGAGTTTACTTGGATTATCGGCCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026047.4-579s21c1
Sequence:CCGGAGATGATGTGGATAAGTTAAACTCGAGTTTAACTTATCCACATCATCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026047.3-1555s1c1
Sequence:CCGGCCCTCGAAATGAATCGAACAACTCGAGTTGTTCGATTCATTTCGAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026047.3-687s1c1
Sequence:CCGGCAGTCCAAAGTAGAACAGTATCTCGAGATACTGTTCTACTTTGGACTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026047.3-1865s1c1
Sequence:CCGGCCACGAGATGAGTGAAGATTTCTCGAGAAATCTTCACTCATCTCGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024546
VALIDATED
RNF219 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 219
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024546.3-1741s21c1
Sequence:CCGGCACTGGATTTGGATGGGTTATCTCGAGATAACCCATCCAAATCCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024546.3-2548s21c1
Sequence:CCGGATGTATCTCGGTTGGATATACCTCGAGGTATATCCAACCGAGATACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024546.3-1948s21c1
Sequence:CCGGCCAGTTCTTGTCCAGTAACTACTCGAGTAGTTACTGGACAAGAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024546.3-1833s21c1
Sequence:CCGGTCCAAAGGTTCTCTAACTAATCTCGAGATTAGTTAGAGAACCTTTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024546.3-2028s21c1
Sequence:CCGGAGCAGTTCACATCGACTATTTCTCGAGAAATAGTCGATGTGAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024546.2-1746s1c1
Sequence:CCGGCACTGGATTTGGATGGGTTATCTCGAGATAACCCATCCAAATCCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137111    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024546.2-1954s1c1
Sequence:CCGGCCAGTTCTTGTCCAGTAACTACTCGAGTAGTTACTGGACAAGAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024546.2-599s1c1
Sequence:CCGGGATAAGCTAAAGGAGGCAAATCTCGAGATTTGCCTCCTTTAGCTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024546.2-3077s1c1
Sequence:CCGGGCTTCATTGTTCCAGATGTAACTCGAGTTACATCTGGAACAATGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024546.2-1563s1c1
Sequence:CCGGGTGAGAAATCAGGCTTATGTTCTCGAGAACATAAGCCTGATTTCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024546.2-781s1c1
Sequence:CCGGCCTGGAACGAAGTGATAAGTACTCGAGTACTTATCACTTCGTTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024546
VALIDATED
RNF219 MISSION shRNA shRNA Plasmid DNA
ring finger protein 219
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024546.3-1741s21c1
Sequence:CCGGCACTGGATTTGGATGGGTTATCTCGAGATAACCCATCCAAATCCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024546.3-2548s21c1
Sequence:CCGGATGTATCTCGGTTGGATATACCTCGAGGTATATCCAACCGAGATACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024546.3-1948s21c1
Sequence:CCGGCCAGTTCTTGTCCAGTAACTACTCGAGTAGTTACTGGACAAGAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024546.3-1833s21c1
Sequence:CCGGTCCAAAGGTTCTCTAACTAATCTCGAGATTAGTTAGAGAACCTTTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024546.3-2028s21c1
Sequence:CCGGAGCAGTTCACATCGACTATTTCTCGAGAAATAGTCGATGTGAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024546.2-1746s1c1
Sequence:CCGGCACTGGATTTGGATGGGTTATCTCGAGATAACCCATCCAAATCCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137111    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024546.2-1954s1c1
Sequence:CCGGCCAGTTCTTGTCCAGTAACTACTCGAGTAGTTACTGGACAAGAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024546.2-599s1c1
Sequence:CCGGGATAAGCTAAAGGAGGCAAATCTCGAGATTTGCCTCCTTTAGCTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024546.2-3077s1c1
Sequence:CCGGGCTTCATTGTTCCAGATGTAACTCGAGTTACATCTGGAACAATGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024546.2-1563s1c1
Sequence:CCGGGTGAGAAATCAGGCTTATGTTCTCGAGAACATAAGCCTGATTTCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024546.2-781s1c1
Sequence:CCGGCCTGGAACGAAGTGATAAGTACTCGAGTACTTATCACTTCGTTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024546
VALIDATED
RNF219 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 219
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024546.3-1741s21c1
Sequence:CCGGCACTGGATTTGGATGGGTTATCTCGAGATAACCCATCCAAATCCAGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024546.3-2548s21c1
Sequence:CCGGATGTATCTCGGTTGGATATACCTCGAGGTATATCCAACCGAGATACATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024546.3-1948s21c1
Sequence:CCGGCCAGTTCTTGTCCAGTAACTACTCGAGTAGTTACTGGACAAGAACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024546.3-1833s21c1
Sequence:CCGGTCCAAAGGTTCTCTAACTAATCTCGAGATTAGTTAGAGAACCTTTGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024546.3-2028s21c1
Sequence:CCGGAGCAGTTCACATCGACTATTTCTCGAGAAATAGTCGATGTGAACTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024546.2-1746s1c1
Sequence:CCGGCACTGGATTTGGATGGGTTATCTCGAGATAACCCATCCAAATCCAGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137111    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024546.2-1954s1c1
Sequence:CCGGCCAGTTCTTGTCCAGTAACTACTCGAGTAGTTACTGGACAAGAACTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024546.2-599s1c1
Sequence:CCGGGATAAGCTAAAGGAGGCAAATCTCGAGATTTGCCTCCTTTAGCTTATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024546.2-3077s1c1
Sequence:CCGGGCTTCATTGTTCCAGATGTAACTCGAGTTACATCTGGAACAATGAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024546.2-1563s1c1
Sequence:CCGGGTGAGAAATCAGGCTTATGTTCTCGAGAACATAAGCCTGATTTCTCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024546.2-781s1c1
Sequence:CCGGCCTGGAACGAAGTGATAAGTACTCGAGTACTTATCACTTCGTTCCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)