EMAIL THIS PAGE TO A FRIEND

RNF2

ring finger protein 2

161 Gene Product Result for
Synonyms: BAP-1 BAP1 DING HIPI3 RING1B RING2
UniProtKB ID: Q99496, B2RBS7, Q5TEN1, Q5TEN2
Gene ID:
Human(6045) Summary: Polycomb group (PcG) of proteins form the multiprotein complexes that are important for the transcription repression of various genes involved in development and cell proliferation. The protein encoded by this gene is one of the PcG proteins. It has been shown to interact with, and suppress the activity of, transcription factor CP2 (TFCP2/CP2). Studies of the mouse counterpart suggested the involvement of this gene in the specification of anterior-posterior axis, as well as in cell proliferation in early development. This protein was also found to interact with huntingtin interacting protein 2 (HIP2), an ubiquitin-conjugating enzyme, and possess ubiquitin ligase activity. [provided by RefSeq, Jul 2008]
Mouse(19821) ring finger protein 2
Rat(304850) ring finger protein 2
Zebrafish(327035) ring finger protein 2
chicken(424452) ring finger protein 2
domestic cat(101086442) ring finger protein 2
dog(480042) ring finger protein 2
domestic guinea pig(100717673) ring finger protein 2
Domestic Rabbit(100344273) ring finger protein 2
naked mole-rat(101708386) ring finger protein 2
cow(540090) ring finger protein 2
sheep(101108242) ring finger protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007212 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007212 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007212 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011277 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011277 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011277 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007212 Rosetta Predictions human pricing
NM_001025667 Rosetta Predictions rat pricing
NM_011277 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007212 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213463 predicted 899
2 SASI_Hs01_00213464 predicted 415
3 SASI_Hs02_00343201 predicted 997
4 SASI_Hs01_00213465 predicted 481
5 SASI_Hs01_00213466 predicted 1043
6 SASI_Hs01_00213467 predicted 977
7 SASI_Hs01_00213469 predicted 1011
8 SASI_Hs01_00213471 predicted 749
9 SASI_Hs02_00343202 predicted 978
10 SASI_Hs01_00213472 predicted 803
11 SASI_Hs01_00213468 predicted 340
12 SASI_Hs01_00213470 predicted 713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025667 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053267 predicted 1023
2 SASI_Rn01_00053269 predicted 859
3 SASI_Rn01_00053271 predicted 790
4 SASI_Rn01_00053272 predicted 561
5 SASI_Rn02_00203257 predicted 439
6 SASI_Rn01_00053273 predicted 337
7 SASI_Rn01_00053274 predicted 300
8 SASI_Rn01_00053275 predicted 516
9 SASI_Rn01_00053276 predicted 838
10 SASI_Rn02_00203258 predicted 571
11 SASI_Rn01_00053268 predicted 342
12 SASI_Rn01_00053270 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011277 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100395 predicted 829
2 SASI_Mm01_00100396 predicted 292
3 SASI_Mm01_00100397 predicted 747
4 SASI_Mm01_00100398 predicted 864
5 SASI_Mm02_00320307 predicted 242
6 SASI_Mm01_00100399 predicted 260
7 SASI_Mm01_00100401 predicted 889
8 SASI_Mm01_00100402 predicted 676
9 SASI_Mm01_00100403 predicted 456
10 SASI_Mm02_00320308 predicted 209
11 SASI_Mm01_00100394 predicted 357
12 SASI_Mm01_00100400 predicted 702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007212
VALIDATED
RNF2 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007212.3-469s21c1
Sequence:CCGGCCCTTAGAAGTGGCAACAAAGCTCGAGCTTTGTTGCCACTTCTAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007212.3-873s21c1
Sequence:CCGGATGGCAATTGATCCAGTAATGCTCGAGCATTACTGGATCAATTGCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007212.3-1714s21c1
Sequence:CCGGAGACCCAAGGCTCAAATTTACCTCGAGGTAAATTTGAGCCTTGGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007212.3-1373s21c1
Sequence:CCGGGTTTACGCTATTCAAATCTTTCTCGAGAAAGATTTGAATAGCGTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007212.3-532s21c1
Sequence:CCGGTAAGGCCAGACCCAAACTTTGCTCGAGCAAAGTTTGGGTCTGGCCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007212.3-991s21c1
Sequence:CCGGACGCCACTGTTGATCACTTATCTCGAGATAAGTGATCAACAGTGGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007212.3-958s21c1
Sequence:CCGGGTGCACAGACGAGATACATAACTCGAGTTATGTATCTCGTCTGTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_007212.2-617s1c1
Sequence:CCGGGCCAGGATCAACAAGCACAATCTCGAGATTGTGCTTGTTGATCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007212.2-1220s1c1
Sequence:CCGGGCACCTACAAAGGAGCACAAACTCGAGTTTGTGCTCCTTTGTAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007212.3-417s21c1
Sequence:CCGGATGACTACAAAGGAGTGTTTACTCGAGTAAACACTCCTTTGTAGTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007212.2-806s1c1
Sequence:CCGGCCTAGTAACAAACGGACCAAACTCGAGTTTGGTCCGTTTGTTACTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007212.2-1022s1c1
Sequence:CCGGGCTGTGAGGTTAGCTTTAGAACTCGAGTTCTAAAGCTAACCTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_007212.2-359s1c1
Sequence:CCGGCGAAGTCTACACAGTGAATTACTCGAGTAATTCACTGTGTAGACTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007212
VALIDATED
RNF2 MISSION shRNA shRNA Plasmid DNA
ring finger protein 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007212.3-469s21c1
Sequence:CCGGCCCTTAGAAGTGGCAACAAAGCTCGAGCTTTGTTGCCACTTCTAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007212.3-873s21c1
Sequence:CCGGATGGCAATTGATCCAGTAATGCTCGAGCATTACTGGATCAATTGCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007212.3-1714s21c1
Sequence:CCGGAGACCCAAGGCTCAAATTTACCTCGAGGTAAATTTGAGCCTTGGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007212.3-1373s21c1
Sequence:CCGGGTTTACGCTATTCAAATCTTTCTCGAGAAAGATTTGAATAGCGTAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007212.3-532s21c1
Sequence:CCGGTAAGGCCAGACCCAAACTTTGCTCGAGCAAAGTTTGGGTCTGGCCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007212.3-991s21c1
Sequence:CCGGACGCCACTGTTGATCACTTATCTCGAGATAAGTGATCAACAGTGGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007212.3-958s21c1
Sequence:CCGGGTGCACAGACGAGATACATAACTCGAGTTATGTATCTCGTCTGTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_007212.2-617s1c1
Sequence:CCGGGCCAGGATCAACAAGCACAATCTCGAGATTGTGCTTGTTGATCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007212.2-1220s1c1
Sequence:CCGGGCACCTACAAAGGAGCACAAACTCGAGTTTGTGCTCCTTTGTAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007212.3-417s21c1
Sequence:CCGGATGACTACAAAGGAGTGTTTACTCGAGTAAACACTCCTTTGTAGTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007212.2-806s1c1
Sequence:CCGGCCTAGTAACAAACGGACCAAACTCGAGTTTGGTCCGTTTGTTACTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007212.2-1022s1c1
Sequence:CCGGGCTGTGAGGTTAGCTTTAGAACTCGAGTTCTAAAGCTAACCTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_007212.2-359s1c1
Sequence:CCGGCGAAGTCTACACAGTGAATTACTCGAGTAATTCACTGTGTAGACTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007212
VALIDATED
RNF2 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007212.3-469s21c1
Sequence:CCGGCCCTTAGAAGTGGCAACAAAGCTCGAGCTTTGTTGCCACTTCTAAGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007212.3-873s21c1
Sequence:CCGGATGGCAATTGATCCAGTAATGCTCGAGCATTACTGGATCAATTGCCATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007212.3-1714s21c1
Sequence:CCGGAGACCCAAGGCTCAAATTTACCTCGAGGTAAATTTGAGCCTTGGGTCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007212.3-1373s21c1
Sequence:CCGGGTTTACGCTATTCAAATCTTTCTCGAGAAAGATTTGAATAGCGTAAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007212.3-532s21c1
Sequence:CCGGTAAGGCCAGACCCAAACTTTGCTCGAGCAAAGTTTGGGTCTGGCCTTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007212.3-991s21c1
Sequence:CCGGACGCCACTGTTGATCACTTATCTCGAGATAAGTGATCAACAGTGGCGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007212.3-958s21c1
Sequence:CCGGGTGCACAGACGAGATACATAACTCGAGTTATGTATCTCGTCTGTGCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_007212.2-617s1c1
Sequence:CCGGGCCAGGATCAACAAGCACAATCTCGAGATTGTGCTTGTTGATCCTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007212.2-1220s1c1
Sequence:CCGGGCACCTACAAAGGAGCACAAACTCGAGTTTGTGCTCCTTTGTAGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007212.3-417s21c1
Sequence:CCGGATGACTACAAAGGAGTGTTTACTCGAGTAAACACTCCTTTGTAGTCATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007212.2-806s1c1
Sequence:CCGGCCTAGTAACAAACGGACCAAACTCGAGTTTGGTCCGTTTGTTACTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007212.2-1022s1c1
Sequence:CCGGGCTGTGAGGTTAGCTTTAGAACTCGAGTTCTAAAGCTAACCTCACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_007212.2-359s1c1
Sequence:CCGGCGAAGTCTACACAGTGAATTACTCGAGTAATTCACTGTGTAGACTTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011277
VALIDATED
RNF2 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011277.2-865s21c1
Sequence:GTACCGGATGCCACTGTTGATCACTTATCTCGAGATAAGTGATCAACAGTGGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011277.2-2711s21c1
Sequence:GTACCGGGTAATCTGTGCCATAAGATTTCTCGAGAAATCTTATGGCACAGATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011277.2-968s21c1
Sequence:CCGGTGAGAAGCAGTACACCATTTACTCGAGTAAATGGTGTACTGCTTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011277.2-472s21c1
Sequence:CCGGCGCATCAGGAAAGGGTCTTAGCTCGAGCTAAGACCCTTTCCTGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011277.2-406s21c1
Sequence:CCGGTAAGGCCAGACCCGAACTTTGCTCGAGCAAAGTTCGGGTCTGGCCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011277.1-451s1c1
Sequence:CCGGCCCAGTCGTGATGAGTATGAACTCGAGTTCATACTCATCACGACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011277.1-261s1c1
Sequence:CCGGCCCAATTTGTTTGGATATGTTCTCGAGAACATATCCAAACAAATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011277.1-803s1c1
Sequence:CCGGCCCATCCAACTCTTATGGAAACTCGAGTTTCCATAAGAGTTGGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011277
VALIDATED
RNF2 MISSION shRNA shRNA Plasmid DNA
ring finger protein 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011277.2-865s21c1
Sequence:GTACCGGATGCCACTGTTGATCACTTATCTCGAGATAAGTGATCAACAGTGGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011277.2-2711s21c1
Sequence:GTACCGGGTAATCTGTGCCATAAGATTTCTCGAGAAATCTTATGGCACAGATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011277.2-968s21c1
Sequence:CCGGTGAGAAGCAGTACACCATTTACTCGAGTAAATGGTGTACTGCTTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011277.2-472s21c1
Sequence:CCGGCGCATCAGGAAAGGGTCTTAGCTCGAGCTAAGACCCTTTCCTGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011277.2-406s21c1
Sequence:CCGGTAAGGCCAGACCCGAACTTTGCTCGAGCAAAGTTCGGGTCTGGCCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011277.1-451s1c1
Sequence:CCGGCCCAGTCGTGATGAGTATGAACTCGAGTTCATACTCATCACGACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011277.1-261s1c1
Sequence:CCGGCCCAATTTGTTTGGATATGTTCTCGAGAACATATCCAAACAAATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011277.1-803s1c1
Sequence:CCGGCCCATCCAACTCTTATGGAAACTCGAGTTTCCATAAGAGTTGGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011277
VALIDATED
RNF2 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011277.2-865s21c1
Sequence:GTACCGGATGCCACTGTTGATCACTTATCTCGAGATAAGTGATCAACAGTGGCATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011277.2-2711s21c1
Sequence:GTACCGGGTAATCTGTGCCATAAGATTTCTCGAGAAATCTTATGGCACAGATTACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011277.2-968s21c1
Sequence:CCGGTGAGAAGCAGTACACCATTTACTCGAGTAAATGGTGTACTGCTTCTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011277.2-472s21c1
Sequence:CCGGCGCATCAGGAAAGGGTCTTAGCTCGAGCTAAGACCCTTTCCTGATGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011277.2-406s21c1
Sequence:CCGGTAAGGCCAGACCCGAACTTTGCTCGAGCAAAGTTCGGGTCTGGCCTTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011277.1-451s1c1
Sequence:CCGGCCCAGTCGTGATGAGTATGAACTCGAGTTCATACTCATCACGACTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011277.1-261s1c1
Sequence:CCGGCCCAATTTGTTTGGATATGTTCTCGAGAACATATCCAAACAAATTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011277.1-803s1c1
Sequence:CCGGCCCATCCAACTCTTATGGAAACTCGAGTTTCCATAAGAGTTGGATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)