EMAIL THIS PAGE TO A FRIEND

RNF38

ring finger protein 38

325 Gene Product Result for
UniProtKB ID: Q9H0F5, A6PVP9, B1AM82, Q7LB33, Q8N0Y0
Gene ID:
Human(152006) Summary: This gene encodes a protein with a coiled-coil motif and a RING-H2 motif (C3H2C2) at its carboxy-terminus. The RING motif is a zinc-binding domain found in a large set of proteins playing roles in diverse cellular processes including oncogenesis, development, signal transduction, and apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Mouse(73469) ring finger protein 38
Rat(171501) ring finger protein 38
chicken(427281) ring finger protein 38
dog(474766) ring finger protein 38
domestic cat(101098996) ring finger protein 38
Horse(100055331) ring finger protein 38
cow(532877) ring finger protein 38
sheep(101110301) ring finger protein 38
naked mole-rat(101699017) ring finger protein 38
Domestic Rabbit(100339947) ring finger protein 38
domestic guinea pig(100731657) ring finger protein 38
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA015853 Anti-RNF38 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175201 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175201 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175201 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022781 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022781 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022781 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083681 MISSION® esiRNA esiRNA human RNF38 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022781 Rosetta Predictions human pricing
NM_194328 Rosetta Predictions human pricing
NM_194329 Rosetta Predictions human pricing
NM_194330 Rosetta Predictions human pricing
NM_194332 Rosetta Predictions human pricing
NM_134467 Rosetta Predictions rat pricing
NM_001038993 Rosetta Predictions mouse pricing
NM_175201 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022781 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147872 predicted 1566
2 SASI_Hs02_00356077 predicted 1670
3 SASI_Hs01_00147873 predicted 1208
4 SASI_Hs01_00147874 predicted 1283
5 SASI_Hs02_00356078 predicted 1676
6 SASI_Hs01_00147876 predicted 767
7 SASI_Hs01_00147878 predicted 735
8 SASI_Hs01_00147879 predicted 1652
9 SASI_Hs02_00356079 predicted 1620
10 SASI_Hs01_00147880 predicted 1659
11 SASI_Hs01_00147875 predicted 1599
12 SASI_Hs01_00147877 predicted 948
13 SASI_Hs01_00147881 predicted 1357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166617 predicted 1735
2 SASI_Hs02_00371478 predicted 1840
3 SASI_Hs01_00166618 predicted 1382
4 SASI_Hs01_00166619 predicted 1451
5 SASI_Hs02_00371479 predicted 1836
6 SASI_Hs01_00166621 predicted 925
7 SASI_Hs01_00166623 predicted 898
8 SASI_Hs01_00166624 predicted 1820
9 SASI_Hs02_00371480 predicted 1791
10 SASI_Hs01_00166625 predicted 1827
11 SASI_Hs01_00166620 predicted 1768
12 SASI_Hs01_00166622 predicted 1110
13 SASI_Hs01_00166626 predicted 1515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194329 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108551 predicted 1414
2 SASI_Hs02_00371481 predicted 1522
3 SASI_Hs01_00108552 predicted 1065
4 SASI_Hs01_00108553 predicted 1137
5 SASI_Hs02_00371482 predicted 1522
6 SASI_Hs01_00108555 predicted 611
7 SASI_Hs01_00108557 predicted 582
8 SASI_Hs01_00108558 predicted 1503
9 SASI_Hs02_00371483 predicted 1470
10 SASI_Hs01_00108559 predicted 1502
11 SASI_Hs01_00108554 predicted 1450
12 SASI_Hs01_00108556 predicted 798
13 SASI_Hs01_00108560 predicted 1207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092707 predicted 1458
2 SASI_Hs02_00371484 predicted 1569
3 SASI_Hs01_00092708 predicted 1112
4 SASI_Hs01_00092709 predicted 1177
5 SASI_Hs02_00371485 predicted 1574
6 SASI_Hs01_00092711 predicted 664
7 SASI_Hs01_00092713 predicted 625
8 SASI_Hs01_00092714 predicted 1543
9 SASI_Hs02_00371486 predicted 1524
10 SASI_Hs01_00092715 predicted 1550
11 SASI_Hs01_00092710 predicted 1496
12 SASI_Hs01_00092712 predicted 840
13 SASI_Hs01_00092716 predicted 1247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134759 predicted 1577
2 SASI_Hs02_00371487 predicted 1689
3 SASI_Hs01_00134760 predicted 1225
4 SASI_Hs01_00134761 predicted 1300
5 SASI_Hs02_00371488 predicted 1686
6 SASI_Hs01_00134763 predicted 783
7 SASI_Hs01_00134765 predicted 746
8 SASI_Hs01_00134766 predicted 1663
9 SASI_Hs02_00371489 predicted 1642
10 SASI_Hs01_00134767 predicted 1673
11 SASI_Hs01_00134762 predicted 1621
12 SASI_Hs01_00134764 predicted 966
13 SASI_Hs01_00134768 predicted 1370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134467 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114766 predicted 909
2 SASI_Rn02_00268079 predicted 1439
3 SASI_Rn01_00114767 predicted 1456
4 SASI_Rn02_00268080 predicted 1462
5 SASI_Rn02_00268081 predicted 1458
6 SASI_Rn01_00114770 predicted 999
7 SASI_Rn01_00114771 predicted 911
8 SASI_Rn01_00114772 predicted 1378
9 SASI_Rn01_00114773 predicted 530
10 SASI_Rn01_00114774 predicted 513
11 SASI_Rn01_00114768 predicted 556
12 SASI_Rn01_00114769 predicted 931
13 SASI_Rn01_00114775 predicted 1298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038993 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181177 predicted 1020
2 SASI_Mm01_00181178 predicted 1287
3 SASI_Mm01_00181179 predicted 636
4 SASI_Mm01_00181180 predicted 1301
5 SASI_Mm01_00181182 predicted 880
6 SASI_Mm01_00181183 predicted 1508
7 SASI_Mm01_00181184 predicted 1114
8 SASI_Mm01_00181185 predicted 1018
9 SASI_Mm01_00181186 predicted 835
10 SASI_Mm02_00289712 predicted 623
11 SASI_Mm01_00181181 predicted 672
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175201 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020656 predicted 974
2 SASI_Mm01_00020657 predicted 1245
3 SASI_Mm01_00020658 predicted 589
4 SASI_Mm01_00020659 predicted 1253
5 SASI_Mm01_00020660 predicted 607
6 SASI_Mm01_00020661 predicted 830
7 SASI_Mm01_00020662 predicted 1456
8 SASI_Mm01_00020663 predicted 1067
9 SASI_Mm01_00020664 predicted 972
10 SASI_Mm01_00020665 predicted 786
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175201
VALIDATED
RNF38 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 38
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175201.4-1104s21c1
Sequence:CCGGAGTACCTTACCCACCATTTATCTCGAGATAAATGGTGGGTAAGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175201.2-681s1c1
Sequence:CCGGCGACATAATTCCATTAGTCAACTCGAGTTGACTAATGGAATTATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175201.2-1616s1c1
Sequence:CCGGGCTTCCTTCGTACAGGTTCAACTCGAGTTGAACCTGTACGAAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175201.2-328s1c1
Sequence:CCGGGCCATCCTAACAAGGTGATTTCTCGAGAAATCACCTTGTTAGGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175201.2-1441s1c1
Sequence:CCGGGCTTACTACCATACGTGCTATCTCGAGATAGCACGTATGGTAGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175201.4-1371s21c1
Sequence:CCGGGCTTCCTTCGTACAGGTTCAACTCGAGTTGAACCTGTACGAAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175201.2-1076s1c1
Sequence:CCGGCCTCATTTCTAGCGATCCGTTCTCGAGAACGGATCGCTAGAAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175201.4-1636s21c1
Sequence:CCGGTGGACTATCCATCGAACTTAACTCGAGTTAAGTTCGATGGATAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175201.4-436s21c1
Sequence:CCGGCGACATAATTCCATTAGTCAACTCGAGTTGACTAATGGAATTATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175201.4-796s21c1
Sequence:CCGGCAGCACTTACCAGTACCATATCTCGAGATATGGTACTGGTAAGTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175201
VALIDATED
RNF38 MISSION shRNA shRNA Plasmid DNA
ring finger protein 38
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175201.4-1104s21c1
Sequence:CCGGAGTACCTTACCCACCATTTATCTCGAGATAAATGGTGGGTAAGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175201.2-681s1c1
Sequence:CCGGCGACATAATTCCATTAGTCAACTCGAGTTGACTAATGGAATTATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175201.2-1616s1c1
Sequence:CCGGGCTTCCTTCGTACAGGTTCAACTCGAGTTGAACCTGTACGAAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175201.2-328s1c1
Sequence:CCGGGCCATCCTAACAAGGTGATTTCTCGAGAAATCACCTTGTTAGGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175201.2-1441s1c1
Sequence:CCGGGCTTACTACCATACGTGCTATCTCGAGATAGCACGTATGGTAGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175201.4-1371s21c1
Sequence:CCGGGCTTCCTTCGTACAGGTTCAACTCGAGTTGAACCTGTACGAAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175201.2-1076s1c1
Sequence:CCGGCCTCATTTCTAGCGATCCGTTCTCGAGAACGGATCGCTAGAAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175201.4-1636s21c1
Sequence:CCGGTGGACTATCCATCGAACTTAACTCGAGTTAAGTTCGATGGATAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175201.4-436s21c1
Sequence:CCGGCGACATAATTCCATTAGTCAACTCGAGTTGACTAATGGAATTATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175201.4-796s21c1
Sequence:CCGGCAGCACTTACCAGTACCATATCTCGAGATATGGTACTGGTAAGTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175201
VALIDATED
RNF38 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 38
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175201.4-1104s21c1
Sequence:CCGGAGTACCTTACCCACCATTTATCTCGAGATAAATGGTGGGTAAGGTACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000040999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175201.2-681s1c1
Sequence:CCGGCGACATAATTCCATTAGTCAACTCGAGTTGACTAATGGAATTATGTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000041001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175201.2-1616s1c1
Sequence:CCGGGCTTCCTTCGTACAGGTTCAACTCGAGTTGAACCTGTACGAAGGAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000041002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175201.2-328s1c1
Sequence:CCGGGCCATCCTAACAAGGTGATTTCTCGAGAAATCACCTTGTTAGGATGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000041000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175201.2-1441s1c1
Sequence:CCGGGCTTACTACCATACGTGCTATCTCGAGATAGCACGTATGGTAGTAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000302812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175201.4-1371s21c1
Sequence:CCGGGCTTCCTTCGTACAGGTTCAACTCGAGTTGAACCTGTACGAAGGAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000040998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175201.2-1076s1c1
Sequence:CCGGCCTCATTTCTAGCGATCCGTTCTCGAGAACGGATCGCTAGAAATGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000304988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175201.4-1636s21c1
Sequence:CCGGTGGACTATCCATCGAACTTAACTCGAGTTAAGTTCGATGGATAGTCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000302739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175201.4-436s21c1
Sequence:CCGGCGACATAATTCCATTAGTCAACTCGAGTTGACTAATGGAATTATGTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000311188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175201.4-796s21c1
Sequence:CCGGCAGCACTTACCAGTACCATATCTCGAGATATGGTACTGGTAAGTGCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022781
VALIDATED
RNF38 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 38
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022781.x-1259s1c1
Sequence:CCGGAGTACCTTATCCTCCATTTATCTCGAGATAAATGGAGGATAAGGTACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022781.x-1527s1c1
Sequence:CCGGCTTCCTTCTTATCGGTTCAATCTCGAGATTGAACCGATAAGAAGGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022781.4-1501s21c1
Sequence:CCGGGACTGACTAAAGCAGATATTGCTCGAGCAATATCTGCTTTAGTCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022781.x-2287s1c1
Sequence:CCGGCAATGTATAATCTGGTGTGTTCTCGAGAACACACCAGATTATACATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022781.x-349s1c1
Sequence:CCGGTCCAGAGTGAAGATAGTCCAACTCGAGTTGGACTATCTTCACTCTGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022781.x-986s1c1
Sequence:CCGGCCTTATTTCTAGTGATCCATTCTCGAGAATGGATCACTAGAAATAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022781.4-2151s21c1
Sequence:CCGGGCGTATGACTGTTGGTGATAACTCGAGTTATCACCAACAGTCATACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022781.4-579s21c1
Sequence:CCGGGATCGTCTGTCTCGACATAATCTCGAGATTATGTCGAGACAGACGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022781.4-1678s21c1
Sequence:CCGGCAAATCGTACTTGCCCAATTTCTCGAGAAATTGGGCAAGTACGATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022781.4-1601s21c1
Sequence:CCGGTGAGTCAAGGCAGCTACTTAGCTCGAGCTAAGTAGCTGCCTTGACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022781.4-1741s21c1
Sequence:CCGGCAACCTAAGAAGCACAAATTTCTCGAGAAATTTGTGCTTCTTAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022781.4-636s21c1
Sequence:CCGGTACGCACAGCAGCAAGCAATACTCGAGTATTGCTTGCTGCTGTGCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022781.4-238s21c1
Sequence:CCGGGCCATCCTAACAAGGTGATTTCTCGAGAAATCACCTTGTTAGGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022781
VALIDATED
RNF38 MISSION shRNA shRNA Plasmid DNA
ring finger protein 38
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022781.x-1259s1c1
Sequence:CCGGAGTACCTTATCCTCCATTTATCTCGAGATAAATGGAGGATAAGGTACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022781.x-1527s1c1
Sequence:CCGGCTTCCTTCTTATCGGTTCAATCTCGAGATTGAACCGATAAGAAGGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022781.4-1501s21c1
Sequence:CCGGGACTGACTAAAGCAGATATTGCTCGAGCAATATCTGCTTTAGTCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022781.x-2287s1c1
Sequence:CCGGCAATGTATAATCTGGTGTGTTCTCGAGAACACACCAGATTATACATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022781.x-349s1c1
Sequence:CCGGTCCAGAGTGAAGATAGTCCAACTCGAGTTGGACTATCTTCACTCTGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022781.x-986s1c1
Sequence:CCGGCCTTATTTCTAGTGATCCATTCTCGAGAATGGATCACTAGAAATAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022781.4-2151s21c1
Sequence:CCGGGCGTATGACTGTTGGTGATAACTCGAGTTATCACCAACAGTCATACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022781.4-579s21c1
Sequence:CCGGGATCGTCTGTCTCGACATAATCTCGAGATTATGTCGAGACAGACGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022781.4-1678s21c1
Sequence:CCGGCAAATCGTACTTGCCCAATTTCTCGAGAAATTGGGCAAGTACGATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022781.4-1601s21c1
Sequence:CCGGTGAGTCAAGGCAGCTACTTAGCTCGAGCTAAGTAGCTGCCTTGACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022781.4-1741s21c1
Sequence:CCGGCAACCTAAGAAGCACAAATTTCTCGAGAAATTTGTGCTTCTTAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022781.4-636s21c1
Sequence:CCGGTACGCACAGCAGCAAGCAATACTCGAGTATTGCTTGCTGCTGTGCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022781.4-238s21c1
Sequence:CCGGGCCATCCTAACAAGGTGATTTCTCGAGAAATCACCTTGTTAGGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022781
VALIDATED
RNF38 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 38
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022781.x-1259s1c1
Sequence:CCGGAGTACCTTATCCTCCATTTATCTCGAGATAAATGGAGGATAAGGTACTTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000004623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022781.x-1527s1c1
Sequence:CCGGCTTCCTTCTTATCGGTTCAATCTCGAGATTGAACCGATAAGAAGGAAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000427191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022781.4-1501s21c1
Sequence:CCGGGACTGACTAAAGCAGATATTGCTCGAGCAATATCTGCTTTAGTCAGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000004620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022781.x-2287s1c1
Sequence:CCGGCAATGTATAATCTGGTGTGTTCTCGAGAACACACCAGATTATACATTGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000004621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022781.x-349s1c1
Sequence:CCGGTCCAGAGTGAAGATAGTCCAACTCGAGTTGGACTATCTTCACTCTGGATTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000004619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022781.x-986s1c1
Sequence:CCGGCCTTATTTCTAGTGATCCATTCTCGAGAATGGATCACTAGAAATAAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000429531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022781.4-2151s21c1
Sequence:CCGGGCGTATGACTGTTGGTGATAACTCGAGTTATCACCAACAGTCATACGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000435934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022781.4-579s21c1
Sequence:CCGGGATCGTCTGTCTCGACATAATCTCGAGATTATGTCGAGACAGACGATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000431291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022781.4-1678s21c1
Sequence:CCGGCAAATCGTACTTGCCCAATTTCTCGAGAAATTGGGCAAGTACGATTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000426924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022781.4-1601s21c1
Sequence:CCGGTGAGTCAAGGCAGCTACTTAGCTCGAGCTAAGTAGCTGCCTTGACTCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000424373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022781.4-1741s21c1
Sequence:CCGGCAACCTAAGAAGCACAAATTTCTCGAGAAATTTGTGCTTCTTAGGTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000413006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022781.4-636s21c1
Sequence:CCGGTACGCACAGCAGCAAGCAATACTCGAGTATTGCTTGCTGCTGTGCGTATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000428659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022781.4-238s21c1
Sequence:CCGGGCCATCCTAACAAGGTGATTTCTCGAGAAATCACCTTGTTAGGATGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???