EMAIL THIS PAGE TO A FRIEND

RNF40

ring finger protein 40, E3 ubiquitin protein ligase

53 Gene Product Result for
Synonyms: BRE1B RBP95 STARING
Gene ID:
Human(9810) Summary: The protein encoded by this gene contains a RING finger, a motif known to be involved in protein-protein and protein-DNA interactions. This protein was reported to interact with the tumor suppressor protein RB1. Studies of the rat counterpart suggested that this protein may function as an E3 ubiquitin-protein ligase, and facilitate the ubiquitination and degradation of syntaxin 1, which is an essential component of the neurotransmitter release machinery. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Mouse(233900) ring finger protein 40
Rat(266712) ring finger protein 40, E3 ubiquitin protein ligase
domestic guinea pig(100714613) ring finger protein 40, E3 ubiquitin protein ligase
naked mole-rat(101701173) ring finger protein 40, E3 ubiquitin protein ligase
cow(539901) ring finger protein 40, E3 ubiquitin protein ligase
sheep(101102446) ring finger protein 40, E3 ubiquitin protein ligase
Zebrafish(798088) ring finger protein 40
Horse(100065215) ring finger protein 40, E3 ubiquitin protein ligase
domestic cat(101092073) ring finger protein 40, E3 ubiquitin protein ligase
dog(489913) ring finger protein 40, E3 ubiquitin protein ligase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014771 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014771 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014771 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172281 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172281 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172281 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014771 Rosetta Predictions human pricing
NM_153471 Rosetta Predictions rat pricing
NM_172281 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014771 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188930 predicted 1034
2 SASI_Hs01_00188931 predicted 372
3 SASI_Hs02_00346263 predicted 1038
4 SASI_Hs01_00188932 predicted 2269
5 SASI_Hs01_00188933 predicted 1573
6 SASI_Hs01_00188934 predicted 2976
7 SASI_Hs01_00188935 predicted 1560
8 SASI_Hs01_00188936 predicted 1293
9 SASI_Hs01_00188937 predicted 2491
10 SASI_Hs01_00188938 predicted 2165
11 SASI_Hs01_00188939 predicted 2396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153471 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030564 predicted 2142
2 SASI_Rn01_00030565 predicted 1122
3 SASI_Rn01_00030566 predicted 794
4 SASI_Rn01_00030567 predicted 2846
5 SASI_Rn01_00030569 predicted 518
6 SASI_Rn01_00030570 predicted 2240
7 SASI_Rn01_00030571 predicted 919
8 SASI_Rn01_00030572 predicted 1478
9 SASI_Rn02_00268984 predicted 1147
10 SASI_Rn02_00268985 predicted 2948
11 SASI_Rn01_00030563 predicted 1784
12 SASI_Rn01_00030568 predicted 2861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172281 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065241 predicted 1128
2 SASI_Mm01_00065242 predicted 1372
3 SASI_Mm01_00065243 predicted 2365
4 SASI_Mm01_00065245 predicted 715
5 SASI_Mm01_00065246 predicted 2829
6 SASI_Mm01_00065247 predicted 2961
7 SASI_Mm01_00065248 predicted 1930
8 SASI_Mm01_00065249 predicted 797
9 SASI_Mm01_00065250 predicted 1697
10 SASI_Mm02_00343768 predicted 864
11 SASI_Mm01_00065244 predicted 521
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014771
VALIDATED
RNF40 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 40, E3 ubiquitin protein ligase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014771.2-1510s21c1
Sequence:CCGGCGCATCGAGTTTGAGCAGAATCTCGAGATTCTGCTCAAACTCGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014771.2-1573s21c1
Sequence:CCGGCGCCACCTGATTAGTAGTCTTCTCGAGAAGACTACTAATCAGGTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014771.2-3480s1c1
Sequence:CCGGGCTGTGATCTACCCTAGAGAACTCGAGTTCTCTAGGGTAGATCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014771.2-1110s1c1
Sequence:CCGGGCAGAAGTTTGAGATGCTGAACTCGAGTTCAGCATCTCAAACTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014771.2-1110s21c1
Sequence:CCGGGCAGAAGTTTGAGATGCTGAACTCGAGTTCAGCATCTCAAACTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014771.2-3480s21c1
Sequence:CCGGGCTGTGATCTACCCTAGAGAACTCGAGTTCTCTAGGGTAGATCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014771.2-1510s1c1
Sequence:CCGGCGCATCGAGTTTGAGCAGAATCTCGAGATTCTGCTCAAACTCGATGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014771.2-1573s1c1
Sequence:CCGGCGCCACCTGATTAGTAGTCTTCTCGAGAAGACTACTAATCAGGTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014771
VALIDATED
RNF40 MISSION shRNA shRNA Plasmid DNA
ring finger protein 40, E3 ubiquitin protein ligase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014771.2-1510s21c1
Sequence:CCGGCGCATCGAGTTTGAGCAGAATCTCGAGATTCTGCTCAAACTCGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014771.2-1573s21c1
Sequence:CCGGCGCCACCTGATTAGTAGTCTTCTCGAGAAGACTACTAATCAGGTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014771.2-3480s1c1
Sequence:CCGGGCTGTGATCTACCCTAGAGAACTCGAGTTCTCTAGGGTAGATCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014771.2-1110s1c1
Sequence:CCGGGCAGAAGTTTGAGATGCTGAACTCGAGTTCAGCATCTCAAACTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014771.2-1110s21c1
Sequence:CCGGGCAGAAGTTTGAGATGCTGAACTCGAGTTCAGCATCTCAAACTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014771.2-3480s21c1
Sequence:CCGGGCTGTGATCTACCCTAGAGAACTCGAGTTCTCTAGGGTAGATCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014771.2-1510s1c1
Sequence:CCGGCGCATCGAGTTTGAGCAGAATCTCGAGATTCTGCTCAAACTCGATGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014771.2-1573s1c1
Sequence:CCGGCGCCACCTGATTAGTAGTCTTCTCGAGAAGACTACTAATCAGGTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014771
VALIDATED
RNF40 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 40, E3 ubiquitin protein ligase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014771.2-1510s21c1
Sequence:CCGGCGCATCGAGTTTGAGCAGAATCTCGAGATTCTGCTCAAACTCGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014771.2-1573s21c1
Sequence:CCGGCGCCACCTGATTAGTAGTCTTCTCGAGAAGACTACTAATCAGGTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014771.2-3480s1c1
Sequence:CCGGGCTGTGATCTACCCTAGAGAACTCGAGTTCTCTAGGGTAGATCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014771.2-1110s1c1
Sequence:CCGGGCAGAAGTTTGAGATGCTGAACTCGAGTTCAGCATCTCAAACTTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014771.2-1110s21c1
Sequence:CCGGGCAGAAGTTTGAGATGCTGAACTCGAGTTCAGCATCTCAAACTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014771.2-3480s21c1
Sequence:CCGGGCTGTGATCTACCCTAGAGAACTCGAGTTCTCTAGGGTAGATCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014771.2-1510s1c1
Sequence:CCGGCGCATCGAGTTTGAGCAGAATCTCGAGATTCTGCTCAAACTCGATGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014771.2-1573s1c1
Sequence:CCGGCGCCACCTGATTAGTAGTCTTCTCGAGAAGACTACTAATCAGGTGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172281
VALIDATED
RNF40 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 40, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172281.1-1625s1c1
Sequence:CCGGCGAGAAGTACAGGCTGAGATTCTCGAGAATCTCAGCCTGTACTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172281.1-973s1c1
Sequence:CCGGGCGAGAACAGAAGCTCAATAACTCGAGTTATTGAGCTTCTGTTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172281.1-187s1c1
Sequence:CCGGGACCACTCTAATCGAACCCATCTCGAGATGGGTTCGATTAGAGTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172281.1-3050s1c1
Sequence:CCGGCCCAAGTGCAACGCAGCCTTTCTCGAGAAAGGCTGCGTTGCACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172281.1-1486s1c1
Sequence:CCGGGCGCATCGAGTTTGAACAGAACTCGAGTTCTGTTCAAACTCGATGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172281
VALIDATED
RNF40 MISSION shRNA shRNA Plasmid DNA
ring finger protein 40, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172281.1-1625s1c1
Sequence:CCGGCGAGAAGTACAGGCTGAGATTCTCGAGAATCTCAGCCTGTACTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172281.1-973s1c1
Sequence:CCGGGCGAGAACAGAAGCTCAATAACTCGAGTTATTGAGCTTCTGTTCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172281.1-187s1c1
Sequence:CCGGGACCACTCTAATCGAACCCATCTCGAGATGGGTTCGATTAGAGTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172281.1-3050s1c1
Sequence:CCGGCCCAAGTGCAACGCAGCCTTTCTCGAGAAAGGCTGCGTTGCACTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172281.1-1486s1c1
Sequence:CCGGGCGCATCGAGTTTGAACAGAACTCGAGTTCTGTTCAAACTCGATGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172281
VALIDATED
RNF40 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 40, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172281.1-1625s1c1
Sequence:CCGGCGAGAAGTACAGGCTGAGATTCTCGAGAATCTCAGCCTGTACTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172281.1-973s1c1
Sequence:CCGGGCGAGAACAGAAGCTCAATAACTCGAGTTATTGAGCTTCTGTTCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172281.1-187s1c1
Sequence:CCGGGACCACTCTAATCGAACCCATCTCGAGATGGGTTCGATTAGAGTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172281.1-3050s1c1
Sequence:CCGGCCCAAGTGCAACGCAGCCTTTCTCGAGAAAGGCTGCGTTGCACTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172281.1-1486s1c1
Sequence:CCGGGCGCATCGAGTTTGAACAGAACTCGAGTTCTGTTCAAACTCGATGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)