EMAIL THIS PAGE TO A FRIEND

RNF43

ring finger protein 43

144 Gene Product Result for
Synonyms: RNF124 URCC
Gene ID:
Human(54894) Summary: RNF43 is a HAP95 (AKAP8L; MIM 609475) binding ubiquitin ligase that promotes cell growth and is upregulated in colon cancer (Yagyu et al., 2004 [PubMed 15492824]
Mouse(207742) ring finger protein 43
Rat(303412) ring finger protein 43
chicken(100857874) ring finger protein 43
dog(491114) ring finger protein 43
Horse(100057001) ring finger protein 43
domestic cat(101097109) ring finger protein 43
domestic guinea pig(100725020) ring finger protein 43
Domestic Rabbit(100354815) ring finger protein 43
naked mole-rat(101711043) ring finger protein 43
cow(784035) ring finger protein 43
sheep(101123312) ring finger protein 43
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017763 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017763 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017763 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172448 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172448 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172448 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058181 MISSION® esiRNA esiRNA human RNF43 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017763 Rosetta Predictions human pricing
XM_001081171 Rosetta Predictions rat pricing
XM_220829 Rosetta Predictions rat pricing
NM_172448 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017763 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099743 predicted 2807
2 SASI_Hs01_00099745 predicted 1558
3 SASI_Hs01_00099746 predicted 1238
4 SASI_Hs01_00099747 predicted 1521
5 SASI_Hs01_00099748 predicted 1235
6 SASI_Hs01_00099749 predicted 1123
7 SASI_Hs01_00099750 predicted 2347
8 SASI_Hs01_00099751 predicted 2720
9 SASI_Hs02_00350589 predicted 3167
10 SASI_Hs02_00350590 predicted 1483
11 SASI_Hs01_00099742 predicted 3473
12 SASI_Hs01_00099744 predicted 2473
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081171 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370901 predicted 938
2 SASI_Rn02_00370902 predicted 2076
3 SASI_Rn02_00370903 predicted 1675
4 SASI_Rn02_00370904 predicted 866
5 SASI_Rn02_00370905 predicted 616
6 SASI_Rn02_00370906 predicted 915
7 SASI_Rn02_00370907 predicted 294
8 SASI_Rn02_00370908 predicted 1173
9 SASI_Rn02_00370909 predicted 2122
10 SASI_Rn02_00370910 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220829 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379564 predicted 2079
2 SASI_Rn02_00379565 predicted 1679
3 SASI_Rn02_00379566 predicted 1351
4 SASI_Rn02_00379567 predicted 2119
5 SASI_Rn02_00379568 predicted 1429
6 SASI_Rn02_00379569 predicted 1403
7 SASI_Rn02_00379570 predicted 296
8 SASI_Rn02_00379571 predicted 2077
9 SASI_Rn02_00379572 predicted 1631
10 SASI_Rn02_00379573 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172448 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093208 predicted 1964
2 SASI_Mm01_00093209 predicted 2319
3 SASI_Mm01_00093210 predicted 1492
4 SASI_Mm01_00093211 predicted 1554
5 SASI_Mm02_00343957 predicted 803
6 SASI_Mm01_00093212 predicted 1196
7 SASI_Mm02_00343958 predicted 921
8 SASI_Mm01_00093213 predicted 1135
9 SASI_Mm01_00093214 predicted 1351
10 SASI_Mm01_00093215 predicted 1655
11 SASI_Mm01_00093216 predicted 522
12 SASI_Mm01_00093217 predicted 1504
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017763
VALIDATED
RNF43 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 43
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017763.4-3318s21c1
Sequence:CCGGAGTGTGCTCCAGATGTGTTTGCTCGAGCAAACACATCTGGAGCACACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017763.4-1214s21c1
Sequence:CCGGATGCCAGTGATGACGACAATCCTCGAGGATTGTCGTCATCACTGGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017763.4-1885s21c1
Sequence:CCGGATCACAGAGGGAGATTCATTTCTCGAGAAATGAATCTCCCTCTGTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_017763.x-364s1c1
Sequence:CCGGGAAGGTGTGTTTGCTGGTGTTCTCGAGAACACCAGCAAACACACCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017763.4-1063s21c1
Sequence:CCGGGCAGAACAGAAAGCTATTATCCTCGAGGATAATAGCTTTCTGTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017763.4-2462s21c1
Sequence:CCGGTAGTGTACTGCAGCCCTAAAGCTCGAGCTTTAGGGCTGCAGTACACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017763.x-2935s1c1
Sequence:CCGGGCAGAACGCATGACACCTTATCTCGAGATAAGGTGTCATGCGTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_017763.x-1425s1c1
Sequence:CCGGCCACCTCCAATCCACCTCACACTCGAGTGTGAGGTGGATTGGAGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017763.x-714s1c1
Sequence:CCGGCCATGTGAGGATTGAGCTGAACTCGAGTTCAGCTCAATCCTCACATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_017763.x-1183s1c1
Sequence:CCGGCTCCACCTCATTCGCCAGCATCTCGAGATGCTGGCGAATGAGGTGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017763
VALIDATED
RNF43 MISSION shRNA shRNA Plasmid DNA
ring finger protein 43
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017763.4-3318s21c1
Sequence:CCGGAGTGTGCTCCAGATGTGTTTGCTCGAGCAAACACATCTGGAGCACACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017763.4-1214s21c1
Sequence:CCGGATGCCAGTGATGACGACAATCCTCGAGGATTGTCGTCATCACTGGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017763.4-1885s21c1
Sequence:CCGGATCACAGAGGGAGATTCATTTCTCGAGAAATGAATCTCCCTCTGTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_017763.x-364s1c1
Sequence:CCGGGAAGGTGTGTTTGCTGGTGTTCTCGAGAACACCAGCAAACACACCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017763.4-1063s21c1
Sequence:CCGGGCAGAACAGAAAGCTATTATCCTCGAGGATAATAGCTTTCTGTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017763.4-2462s21c1
Sequence:CCGGTAGTGTACTGCAGCCCTAAAGCTCGAGCTTTAGGGCTGCAGTACACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017763.x-2935s1c1
Sequence:CCGGGCAGAACGCATGACACCTTATCTCGAGATAAGGTGTCATGCGTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_017763.x-1425s1c1
Sequence:CCGGCCACCTCCAATCCACCTCACACTCGAGTGTGAGGTGGATTGGAGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017763.x-714s1c1
Sequence:CCGGCCATGTGAGGATTGAGCTGAACTCGAGTTCAGCTCAATCCTCACATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_017763.x-1183s1c1
Sequence:CCGGCTCCACCTCATTCGCCAGCATCTCGAGATGCTGGCGAATGAGGTGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017763
VALIDATED
RNF43 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 43
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017763.4-3318s21c1
Sequence:CCGGAGTGTGCTCCAGATGTGTTTGCTCGAGCAAACACATCTGGAGCACACTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000422812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017763.4-1214s21c1
Sequence:CCGGATGCCAGTGATGACGACAATCCTCGAGGATTGTCGTCATCACTGGCATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000422519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017763.4-1885s21c1
Sequence:CCGGATCACAGAGGGAGATTCATTTCTCGAGAAATGAATCTCCCTCTGTGATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000004216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_017763.x-364s1c1
Sequence:CCGGGAAGGTGTGTTTGCTGGTGTTCTCGAGAACACCAGCAAACACACCTTCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000424439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017763.4-1063s21c1
Sequence:CCGGGCAGAACAGAAAGCTATTATCCTCGAGGATAATAGCTTTCTGTTCTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000422557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017763.4-2462s21c1
Sequence:CCGGTAGTGTACTGCAGCCCTAAAGCTCGAGCTTTAGGGCTGCAGTACACTATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000004219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017763.x-2935s1c1
Sequence:CCGGGCAGAACGCATGACACCTTATCTCGAGATAAGGTGTCATGCGTTCTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000004218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_017763.x-1425s1c1
Sequence:CCGGCCACCTCCAATCCACCTCACACTCGAGTGTGAGGTGGATTGGAGGTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000004217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017763.x-714s1c1
Sequence:CCGGCCATGTGAGGATTGAGCTGAACTCGAGTTCAGCTCAATCCTCACATGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000010861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_017763.x-1183s1c1
Sequence:CCGGCTCCACCTCATTCGCCAGCATCTCGAGATGCTGGCGAATGAGGTGGAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172448
VALIDATED
RNF43 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 43
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172448.3-805s21c1
Sequence:CCGGTCACTTTGGAAGGCGTGTTTGCTCGAGCAAACACGCCTTCCAAAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172448.3-1977s21c1
Sequence:CCGGCGCAGCGGTTACTTGGCAGATCTCGAGATCTGCCAAGTAACCGCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172448.3-1660s21c1
Sequence:CCGGACGCCCACTATCATCTTCCTTCTCGAGAAGGAAGATGATAGTGGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172448.1-1019s1c1
Sequence:CCGGACGCCCACTATCATCTTCCTTCTCGAGAAGGAAGATGATAGTGGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172448.1-1772s1c1
Sequence:CCGGCCAACCCAACAGCTTCTTCAACTCGAGTTGAAGAAGCTGTTGGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172448.1-917s1c1
Sequence:CCGGTCAACATCGTAGAGGGAGATTCTCGAGAATCTCCCTCTACGATGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172448.1-1336s1c1
Sequence:CCGGCGCAGCGGTTACTTGGCAGATCTCGAGATCTGCCAAGTAACCGCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172448.3-2413s21c1
Sequence:CCGGCCAACCCAACAGCTTCTTCAACTCGAGTTGAAGAAGCTGTTGGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172448.3-3452s21c1
Sequence:CCGGGCAACTTCAGCTATATCATTTCTCGAGAAATGATATAGCTGAAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172448.1-388s1c1
Sequence:CCGGCTCTTTGACATCACCGAGGATCTCGAGATCCTCGGTGATGTCAAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172448
VALIDATED
RNF43 MISSION shRNA shRNA Plasmid DNA
ring finger protein 43
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172448.3-805s21c1
Sequence:CCGGTCACTTTGGAAGGCGTGTTTGCTCGAGCAAACACGCCTTCCAAAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172448.3-1977s21c1
Sequence:CCGGCGCAGCGGTTACTTGGCAGATCTCGAGATCTGCCAAGTAACCGCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172448.3-1660s21c1
Sequence:CCGGACGCCCACTATCATCTTCCTTCTCGAGAAGGAAGATGATAGTGGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172448.1-1019s1c1
Sequence:CCGGACGCCCACTATCATCTTCCTTCTCGAGAAGGAAGATGATAGTGGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172448.1-1772s1c1
Sequence:CCGGCCAACCCAACAGCTTCTTCAACTCGAGTTGAAGAAGCTGTTGGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172448.1-917s1c1
Sequence:CCGGTCAACATCGTAGAGGGAGATTCTCGAGAATCTCCCTCTACGATGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172448.1-1336s1c1
Sequence:CCGGCGCAGCGGTTACTTGGCAGATCTCGAGATCTGCCAAGTAACCGCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172448.3-2413s21c1
Sequence:CCGGCCAACCCAACAGCTTCTTCAACTCGAGTTGAAGAAGCTGTTGGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172448.3-3452s21c1
Sequence:CCGGGCAACTTCAGCTATATCATTTCTCGAGAAATGATATAGCTGAAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172448.1-388s1c1
Sequence:CCGGCTCTTTGACATCACCGAGGATCTCGAGATCCTCGGTGATGTCAAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172448
VALIDATED
RNF43 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 43
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172448.3-805s21c1
Sequence:CCGGTCACTTTGGAAGGCGTGTTTGCTCGAGCAAACACGCCTTCCAAAGTGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000316546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172448.3-1977s21c1
Sequence:CCGGCGCAGCGGTTACTTGGCAGATCTCGAGATCTGCCAAGTAACCGCTGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000316616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172448.3-1660s21c1
Sequence:CCGGACGCCCACTATCATCTTCCTTCTCGAGAAGGAAGATGATAGTGGGCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000040792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172448.1-1019s1c1
Sequence:CCGGACGCCCACTATCATCTTCCTTCTCGAGAAGGAAGATGATAGTGGGCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000040788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172448.1-1772s1c1
Sequence:CCGGCCAACCCAACAGCTTCTTCAACTCGAGTTGAAGAAGCTGTTGGGTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000040791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172448.1-917s1c1
Sequence:CCGGTCAACATCGTAGAGGGAGATTCTCGAGAATCTCCCTCTACGATGTTGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000040790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172448.1-1336s1c1
Sequence:CCGGCGCAGCGGTTACTTGGCAGATCTCGAGATCTGCCAAGTAACCGCTGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000349104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172448.3-2413s21c1
Sequence:CCGGCCAACCCAACAGCTTCTTCAACTCGAGTTGAAGAAGCTGTTGGGTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000304886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172448.3-3452s21c1
Sequence:CCGGGCAACTTCAGCTATATCATTTCTCGAGAAATGATATAGCTGAAGTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000040789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172448.1-388s1c1
Sequence:CCGGCTCTTTGACATCACCGAGGATCTCGAGATCCTCGGTGATGTCAAAGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???