EMAIL THIS PAGE TO A FRIEND

RNF8

ring finger protein 8, E3 ubiquitin protein ligase

186 Gene Product Result for
Synonyms: hRNF8
UniProtKB ID: O76064, A6NN24, A8MYC0, B4DPG0, Q53H16, Q5NKW5
Gene ID:
Human(9025) Summary: The protein encoded by this gene contains a RING finger motif and an FHA domain. This protein has been shown to interact with several class II ubiquitin-conjugating enzymes (E2), including UBE2E1/UBCH6, UBE2E2, and UBE2E3, and may act as an ubiquitin ligase (E3) in the ubiquitination of certain nuclear proteins. This protein is also known to play a role in the DNA damage response and depletion of this protein causes cell growth inhibition and cell cycle arrest. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
Mouse(58230) ring finger protein 8
Rat(361815) ring finger protein 8, E3 ubiquitin protein ligase
Zebrafish(404050) ring finger protein 8, E3 ubiquitin protein ligase
chicken(421435) ring finger protein 8, E3 ubiquitin protein ligase
dog(481775) ring finger protein 8, E3 ubiquitin protein ligase
domestic cat(101082654) ring finger protein 8, E3 ubiquitin protein ligase
cow(515933) ring finger protein 8
sheep(101103680) ring finger protein 8, E3 ubiquitin protein ligase
naked mole-rat(101703952) ring finger protein 8, E3 ubiquitin protein ligase
domestic guinea pig(100725403) ring finger protein 8, E3 ubiquitin protein ligase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003958 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003958 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003958 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021419 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021419 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021419 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146141 MISSION® esiRNA esiRNA human RNF8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003958 Rosetta Predictions human pricing
NM_183078 Rosetta Predictions human pricing
NM_001025727 Rosetta Predictions rat pricing
NM_021419 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003958 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018104 predicted 578
2 SASI_Hs01_00018105 predicted 409
3 SASI_Hs02_00336630 predicted 199
4 SASI_Hs01_00018106 predicted 485
5 SASI_Hs01_00018107 predicted 428
6 SASI_Hs01_00018108 predicted 772
7 SASI_Hs01_00018109 predicted 656
8 SASI_Hs01_00018110 predicted 900
9 SASI_Hs01_00018111 predicted 419
10 SASI_Hs01_00018112 predicted 433
11 SASI_Hs01_00018113 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050752 predicted 582
2 SASI_Hs01_00050753 predicted 406
3 SASI_Hs02_00371221 predicted 202
4 SASI_Hs01_00050754 predicted 484
5 SASI_Hs01_00050755 predicted 433
6 SASI_Hs01_00050756 predicted 779
7 SASI_Hs01_00050757 predicted 657
8 SASI_Hs01_00050758 predicted 904
9 SASI_Hs01_00050759 predicted 424
10 SASI_Hs01_00050760 predicted 427
11 SASI_Hs01_00050761 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025727 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072876 predicted 292
2 SASI_Rn01_00072877 predicted 1250
3 SASI_Rn01_00072879 predicted 633
4 SASI_Rn01_00072880 predicted 442
5 SASI_Rn01_00072881 predicted 1590
6 SASI_Rn01_00072882 predicted 242
7 SASI_Rn01_00072883 predicted 817
8 SASI_Rn02_00203358 predicted 323
9 SASI_Rn01_00072884 predicted 499
10 SASI_Rn02_00203359 predicted 298
11 SASI_Rn01_00072878 predicted 325
12 SASI_Rn01_00072885 predicted 209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042904 predicted 567
2 SASI_Mm01_00042905 predicted 693
3 SASI_Mm02_00326057 predicted 545
4 SASI_Mm01_00042906 predicted 273
5 SASI_Mm01_00042907 predicted 1022
6 SASI_Mm01_00042908 predicted 376
7 SASI_Mm01_00042909 predicted 483
8 SASI_Mm01_00042910 predicted 642
9 SASI_Mm01_00042912 predicted 372
10 SASI_Mm01_00042913 predicted 820
11 SASI_Mm01_00042911 predicted 389
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003958
VALIDATED
RNF8 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 8, E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003958.3-1122s21c1
Sequence:CCGGTGGAGCAACTAGAGAAGACTTCTCGAGAAGTCTTCTCTAGTTGCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003958.3-1904s21c1
Sequence:CCGGTACATGTCGAAAGAGTTATTTCTCGAGAAATAACTCTTTCGACATGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003437    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003958.x-4163s1c1
Sequence:CCGGGCCTGAATGTACTATGTTTAACTCGAGTTAAACATAGTACATTCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003958.x-562s1c1
Sequence:CCGGCCAAAGAATGACCAAATGATACTCGAGTATCATTTGGTCATTCTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003958.x-1257s1c1
Sequence:CCGGCAAAGAATTAGAGCAGACCAACTCGAGTTGGTCTGCTCTAATTCTTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003958.x-1079s1c1
Sequence:CCGGTGGAGCAACTAGAGAAGACTTCTCGAGAAGTCTTCTCTAGTTGCTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003958.x-952s1c1
Sequence:CCGGGAAGCCGTTATGAATGTGAAACTCGAGTTTCACATTCATAACGGCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003958.3-605s21c1
Sequence:CCGGCCAAAGAATGACCAAATGATACTCGAGTATCATTTGGTCATTCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003958.3-995s21c1
Sequence:CCGGGAAGCCGTTATGAATGTGAAACTCGAGTTTCACATTCATAACGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003958.3-468s21c1
Sequence:CCGGTGGAACCTTTAAGGGTCTATTCTCGAGAATAGACCCTTAAAGGTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003958
VALIDATED
RNF8 MISSION shRNA shRNA Plasmid DNA
ring finger protein 8, E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003958.3-1122s21c1
Sequence:CCGGTGGAGCAACTAGAGAAGACTTCTCGAGAAGTCTTCTCTAGTTGCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003958.3-1904s21c1
Sequence:CCGGTACATGTCGAAAGAGTTATTTCTCGAGAAATAACTCTTTCGACATGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003437    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003958.x-4163s1c1
Sequence:CCGGGCCTGAATGTACTATGTTTAACTCGAGTTAAACATAGTACATTCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003958.x-562s1c1
Sequence:CCGGCCAAAGAATGACCAAATGATACTCGAGTATCATTTGGTCATTCTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003958.x-1257s1c1
Sequence:CCGGCAAAGAATTAGAGCAGACCAACTCGAGTTGGTCTGCTCTAATTCTTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003958.x-1079s1c1
Sequence:CCGGTGGAGCAACTAGAGAAGACTTCTCGAGAAGTCTTCTCTAGTTGCTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003958.x-952s1c1
Sequence:CCGGGAAGCCGTTATGAATGTGAAACTCGAGTTTCACATTCATAACGGCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003958.3-605s21c1
Sequence:CCGGCCAAAGAATGACCAAATGATACTCGAGTATCATTTGGTCATTCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003958.3-995s21c1
Sequence:CCGGGAAGCCGTTATGAATGTGAAACTCGAGTTTCACATTCATAACGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003958.3-468s21c1
Sequence:CCGGTGGAACCTTTAAGGGTCTATTCTCGAGAATAGACCCTTAAAGGTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003958
VALIDATED
RNF8 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 8, E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003958.3-1122s21c1
Sequence:CCGGTGGAGCAACTAGAGAAGACTTCTCGAGAAGTCTTCTCTAGTTGCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003958.3-1904s21c1
Sequence:CCGGTACATGTCGAAAGAGTTATTTCTCGAGAAATAACTCTTTCGACATGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003437    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003958.x-4163s1c1
Sequence:CCGGGCCTGAATGTACTATGTTTAACTCGAGTTAAACATAGTACATTCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003958.x-562s1c1
Sequence:CCGGCCAAAGAATGACCAAATGATACTCGAGTATCATTTGGTCATTCTTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003958.x-1257s1c1
Sequence:CCGGCAAAGAATTAGAGCAGACCAACTCGAGTTGGTCTGCTCTAATTCTTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003958.x-1079s1c1
Sequence:CCGGTGGAGCAACTAGAGAAGACTTCTCGAGAAGTCTTCTCTAGTTGCTCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003958.x-952s1c1
Sequence:CCGGGAAGCCGTTATGAATGTGAAACTCGAGTTTCACATTCATAACGGCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003958.3-605s21c1
Sequence:CCGGCCAAAGAATGACCAAATGATACTCGAGTATCATTTGGTCATTCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003958.3-995s21c1
Sequence:CCGGGAAGCCGTTATGAATGTGAAACTCGAGTTTCACATTCATAACGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003958.3-468s21c1
Sequence:CCGGTGGAACCTTTAAGGGTCTATTCTCGAGAATAGACCCTTAAAGGTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021419
VALIDATED
RNF8 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 8, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021419.1-1191s1c1
Sequence:CCGGGCTCTAATGGAAGAACTAAATCTCGAGATTTAGTTCTTCCATTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021419.1-583s1c1
Sequence:CCGGGCTCGAGAACTAAGAGGAAATCTCGAGATTTCCTCTTAGTTCTCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021419.1-422s1c1
Sequence:CCGGACAGGGTTATTGCATCCGTAACTCGAGTTACGGATGCAATAACCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021419.1-1443s1c1
Sequence:CCGGCGGAAAGTAGAGTGTCCCATTCTCGAGAATGGGACACTCTACTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021419.1-663s1c1
Sequence:CCGGCTGGCTAATGTCGCCAGTAAACTCGAGTTTACTGGCGACATTAGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021419
VALIDATED
RNF8 MISSION shRNA shRNA Plasmid DNA
ring finger protein 8, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021419.1-1191s1c1
Sequence:CCGGGCTCTAATGGAAGAACTAAATCTCGAGATTTAGTTCTTCCATTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021419.1-583s1c1
Sequence:CCGGGCTCGAGAACTAAGAGGAAATCTCGAGATTTCCTCTTAGTTCTCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021419.1-422s1c1
Sequence:CCGGACAGGGTTATTGCATCCGTAACTCGAGTTACGGATGCAATAACCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021419.1-1443s1c1
Sequence:CCGGCGGAAAGTAGAGTGTCCCATTCTCGAGAATGGGACACTCTACTTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021419.1-663s1c1
Sequence:CCGGCTGGCTAATGTCGCCAGTAAACTCGAGTTTACTGGCGACATTAGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021419
VALIDATED
RNF8 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 8, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021419.1-1191s1c1
Sequence:CCGGGCTCTAATGGAAGAACTAAATCTCGAGATTTAGTTCTTCCATTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021419.1-583s1c1
Sequence:CCGGGCTCGAGAACTAAGAGGAAATCTCGAGATTTCCTCTTAGTTCTCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021419.1-422s1c1
Sequence:CCGGACAGGGTTATTGCATCCGTAACTCGAGTTACGGATGCAATAACCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021419.1-1443s1c1
Sequence:CCGGCGGAAAGTAGAGTGTCCCATTCTCGAGAATGGGACACTCTACTTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021419.1-663s1c1
Sequence:CCGGCTGGCTAATGTCGCCAGTAAACTCGAGTTTACTGGCGACATTAGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)