EMAIL THIS PAGE TO A FRIEND

RNPEP

arginyl aminopeptidase (aminopeptidase B)

52 Gene Product Result for
UniProtKB ID: Q9H4A4, Q9BVM9, Q9H1D4, Q9NPT7
Gene ID:
Mouse(215615) arginyl aminopeptidase (aminopeptidase B)
Rat(81761) arginyl aminopeptidase (aminopeptidase B)
Zebrafish(437014) arginyl aminopeptidase (aminopeptidase B)
domestic cat(101100613) arginyl aminopeptidase (aminopeptidase B)
dog(490236) arginyl aminopeptidase (aminopeptidase B)
chicken(421165) arginyl aminopeptidase (aminopeptidase B)
domestic guinea pig(100724495) arginyl aminopeptidase (aminopeptidase B)
naked mole-rat(101712935) arginyl aminopeptidase (aminopeptidase B)
Domestic Rabbit(100342982) arginyl aminopeptidase (aminopeptidase B)
cow(282040) arginyl aminopeptidase (aminopeptidase B)
sheep(101114205) arginyl aminopeptidase (aminopeptidase B)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
482609 N-[(2S,3R)-3-Amino-2-hydroxy-4-phenylbutyryl]-L-leucine 97% human, mouse, rat pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0933 AQUA Peptide IEPGVDPDDTYNETPYE[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145417 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145417 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145417 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020216 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020216 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020216 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020216 Rosetta Predictions human pricing
NM_031097 Rosetta Predictions rat pricing
NM_145417 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020216 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240002 predicted 665
2 SASI_Hs02_00353151 predicted 1170
3 SASI_Hs01_00240003 predicted 1046
4 SASI_Hs01_00240004 predicted 886
5 SASI_Hs01_00240005 predicted 1193
6 SASI_Hs01_00240006 predicted 653
7 SASI_Hs01_00240007 predicted 1583
8 SASI_Hs01_00240008 predicted 729
9 SASI_Hs01_00240009 predicted 2029
10 SASI_Hs01_00240010 predicted 599
11 SASI_Hs01_00240011 predicted 1411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031097 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055326 predicted 1240
2 SASI_Rn01_00055327 predicted 1675
3 SASI_Rn01_00055328 predicted 1327
4 SASI_Rn01_00055329 predicted 1370
5 SASI_Rn01_00055330 predicted 1604
6 SASI_Rn01_00055331 predicted 565
7 SASI_Rn01_00055332 predicted 1169
8 SASI_Rn01_00055333 predicted 846
9 SASI_Rn02_00264346 predicted 1364
10 SASI_Rn01_00055334 predicted 952
11 SASI_Rn01_00055335 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145417 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051747 predicted 1692
2 SASI_Mm01_00051748 predicted 885
3 SASI_Mm01_00051749 predicted 1618
4 SASI_Mm01_00051751 predicted 1269
5 SASI_Mm01_00051752 predicted 1756
6 SASI_Mm01_00051753 predicted 1192
7 SASI_Mm02_00340764 predicted 591
8 SASI_Mm01_00051754 predicted 1316
9 SASI_Mm01_00051756 predicted 869
10 SASI_Mm02_00340765 predicted 1099
11 SASI_Mm01_00051750 predicted 1376
12 SASI_Mm01_00051755 predicted 1431
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145417
VALIDATED
RNPEP MISSION shRNA Bacterial Glycerol Stock
arginyl aminopeptidase (aminopeptidase B)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145417.3-590s21c1
Sequence:CCGGGCGGTCTTAAACCGAGCCTTTCTCGAGAAAGGCTCGGTTTAAGACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145417.3-1678s21c1
Sequence:CCGGGCTTGTCTACTTCCTAGATAACTCGAGTTATCTAGGAAGTAGACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145417.3-1394s21c1
Sequence:CCGGGCCTATGTAGATGAGTTTAAACTCGAGTTTAAACTCATCTACATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145417.3-2125s21c1
Sequence:CCGGGAGCTTCTGTTCTTTGGGTTTCTCGAGAAACCCAAAGAACAGAAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145417.3-653s21c1
Sequence:CCGGGCTCTTATTGAGGTTCCAGATCTCGAGATCTGGAACCTCAATAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031114    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145417.1-2096s1c1
Sequence:CCGGGAGCTTCTGTTCTTTGGGTTTCTCGAGAAACCCAAAGAACAGAAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145417.1-1649s1c1
Sequence:CCGGGCTTGTCTACTTCCTAGATAACTCGAGTTATCTAGGAAGTAGACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145417.1-624s1c1
Sequence:CCGGGCTCTTATTGAGGTTCCAGATCTCGAGATCTGGAACCTCAATAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145417.1-1365s1c1
Sequence:CCGGGCCTATGTAGATGAGTTTAAACTCGAGTTTAAACTCATCTACATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145417.1-561s1c1
Sequence:CCGGGCGGTCTTAAACCGAGCCTTTCTCGAGAAAGGCTCGGTTTAAGACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145417
VALIDATED
RNPEP MISSION shRNA shRNA Plasmid DNA
arginyl aminopeptidase (aminopeptidase B)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145417.3-590s21c1
Sequence:CCGGGCGGTCTTAAACCGAGCCTTTCTCGAGAAAGGCTCGGTTTAAGACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145417.3-1678s21c1
Sequence:CCGGGCTTGTCTACTTCCTAGATAACTCGAGTTATCTAGGAAGTAGACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145417.3-1394s21c1
Sequence:CCGGGCCTATGTAGATGAGTTTAAACTCGAGTTTAAACTCATCTACATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145417.3-2125s21c1
Sequence:CCGGGAGCTTCTGTTCTTTGGGTTTCTCGAGAAACCCAAAGAACAGAAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145417.3-653s21c1
Sequence:CCGGGCTCTTATTGAGGTTCCAGATCTCGAGATCTGGAACCTCAATAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031114    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145417.1-2096s1c1
Sequence:CCGGGAGCTTCTGTTCTTTGGGTTTCTCGAGAAACCCAAAGAACAGAAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145417.1-1649s1c1
Sequence:CCGGGCTTGTCTACTTCCTAGATAACTCGAGTTATCTAGGAAGTAGACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145417.1-624s1c1
Sequence:CCGGGCTCTTATTGAGGTTCCAGATCTCGAGATCTGGAACCTCAATAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145417.1-1365s1c1
Sequence:CCGGGCCTATGTAGATGAGTTTAAACTCGAGTTTAAACTCATCTACATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145417.1-561s1c1
Sequence:CCGGGCGGTCTTAAACCGAGCCTTTCTCGAGAAAGGCTCGGTTTAAGACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145417
VALIDATED
RNPEP MISSION shRNA Lentiviral Transduction Particles
arginyl aminopeptidase (aminopeptidase B)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145417.3-590s21c1
Sequence:CCGGGCGGTCTTAAACCGAGCCTTTCTCGAGAAAGGCTCGGTTTAAGACCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145417.3-1678s21c1
Sequence:CCGGGCTTGTCTACTTCCTAGATAACTCGAGTTATCTAGGAAGTAGACAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145417.3-1394s21c1
Sequence:CCGGGCCTATGTAGATGAGTTTAAACTCGAGTTTAAACTCATCTACATAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145417.3-2125s21c1
Sequence:CCGGGAGCTTCTGTTCTTTGGGTTTCTCGAGAAACCCAAAGAACAGAAGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145417.3-653s21c1
Sequence:CCGGGCTCTTATTGAGGTTCCAGATCTCGAGATCTGGAACCTCAATAAGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031114    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145417.1-2096s1c1
Sequence:CCGGGAGCTTCTGTTCTTTGGGTTTCTCGAGAAACCCAAAGAACAGAAGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145417.1-1649s1c1
Sequence:CCGGGCTTGTCTACTTCCTAGATAACTCGAGTTATCTAGGAAGTAGACAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145417.1-624s1c1
Sequence:CCGGGCTCTTATTGAGGTTCCAGATCTCGAGATCTGGAACCTCAATAAGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145417.1-1365s1c1
Sequence:CCGGGCCTATGTAGATGAGTTTAAACTCGAGTTTAAACTCATCTACATAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145417.1-561s1c1
Sequence:CCGGGCGGTCTTAAACCGAGCCTTTCTCGAGAAAGGCTCGGTTTAAGACCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020216
VALIDATED
RNPEP MISSION shRNA Bacterial Glycerol Stock
arginyl aminopeptidase (aminopeptidase B)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020216.3-2064s21c1
Sequence:CCGGATCAACTTCCTGGAGTTTATACTCGAGTATAAACTCCAGGAAGTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020216.3-658s21c1
Sequence:CCGGGGGAGAAGAGAGGTCCAAATACTCGAGTATTTGGACCTCTCTTCTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020216.3-1240s21c1
Sequence:CCGGACCCGGACGACACCTATAATGCTCGAGCATTATAGGTGTCGTCCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020216.3-1643s1c1
Sequence:CCGGCCTGGATAAGATCCTCCAGAACTCGAGTTCTGGAGGATCTTATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020216.3-606s1c1
Sequence:CCGGGCTCTTATTGAGGTCCCAGATCTCGAGATCTGGGACCTCAATAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020216.3-1064s21c1
Sequence:CCGGGCTCAATGAAGGTTTCACCATCTCGAGATGGTGAAACCTTCATTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020216.3-582s1c1
Sequence:CCGGCCTGCTGTTAAATACAAGTATCTCGAGATACTTGTATTTAACAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020216.3-1064s1c1
Sequence:CCGGGCTCAATGAAGGTTTCACCATCTCGAGATGGTGAAACCTTCATTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020216.3-1925s1c1
Sequence:CCGGGCTCCACAGCAATGTTGTCAACTCGAGTTGACAACATTGCTGTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020216.3-1397s21c1
Sequence:CCGGGGACTTCTACTTGGAATATTTCTCGAGAAATATTCCAAGTAGAAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020216
VALIDATED
RNPEP MISSION shRNA shRNA Plasmid DNA
arginyl aminopeptidase (aminopeptidase B)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020216.3-2064s21c1
Sequence:CCGGATCAACTTCCTGGAGTTTATACTCGAGTATAAACTCCAGGAAGTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020216.3-658s21c1
Sequence:CCGGGGGAGAAGAGAGGTCCAAATACTCGAGTATTTGGACCTCTCTTCTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020216.3-1240s21c1
Sequence:CCGGACCCGGACGACACCTATAATGCTCGAGCATTATAGGTGTCGTCCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020216.3-1643s1c1
Sequence:CCGGCCTGGATAAGATCCTCCAGAACTCGAGTTCTGGAGGATCTTATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020216.3-606s1c1
Sequence:CCGGGCTCTTATTGAGGTCCCAGATCTCGAGATCTGGGACCTCAATAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020216.3-1064s21c1
Sequence:CCGGGCTCAATGAAGGTTTCACCATCTCGAGATGGTGAAACCTTCATTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020216.3-582s1c1
Sequence:CCGGCCTGCTGTTAAATACAAGTATCTCGAGATACTTGTATTTAACAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020216.3-1064s1c1
Sequence:CCGGGCTCAATGAAGGTTTCACCATCTCGAGATGGTGAAACCTTCATTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020216.3-1925s1c1
Sequence:CCGGGCTCCACAGCAATGTTGTCAACTCGAGTTGACAACATTGCTGTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020216.3-1397s21c1
Sequence:CCGGGGACTTCTACTTGGAATATTTCTCGAGAAATATTCCAAGTAGAAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020216
VALIDATED
RNPEP MISSION shRNA Lentiviral Transduction Particles
arginyl aminopeptidase (aminopeptidase B)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020216.3-2064s21c1
Sequence:CCGGATCAACTTCCTGGAGTTTATACTCGAGTATAAACTCCAGGAAGTTGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020216.3-658s21c1
Sequence:CCGGGGGAGAAGAGAGGTCCAAATACTCGAGTATTTGGACCTCTCTTCTCCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020216.3-1240s21c1
Sequence:CCGGACCCGGACGACACCTATAATGCTCGAGCATTATAGGTGTCGTCCGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020216.3-1643s1c1
Sequence:CCGGCCTGGATAAGATCCTCCAGAACTCGAGTTCTGGAGGATCTTATCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020216.3-606s1c1
Sequence:CCGGGCTCTTATTGAGGTCCCAGATCTCGAGATCTGGGACCTCAATAAGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020216.3-1064s21c1
Sequence:CCGGGCTCAATGAAGGTTTCACCATCTCGAGATGGTGAAACCTTCATTGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020216.3-582s1c1
Sequence:CCGGCCTGCTGTTAAATACAAGTATCTCGAGATACTTGTATTTAACAGCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020216.3-1064s1c1
Sequence:CCGGGCTCAATGAAGGTTTCACCATCTCGAGATGGTGAAACCTTCATTGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020216.3-1925s1c1
Sequence:CCGGGCTCCACAGCAATGTTGTCAACTCGAGTTGACAACATTGCTGTGGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020216.3-1397s21c1
Sequence:CCGGGGACTTCTACTTGGAATATTTCTCGAGAAATATTCCAAGTAGAAGTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)