EMAIL THIS PAGE TO A FRIEND

ROBO1

roundabout, axon guidance receptor, homolog 1 (Drosophila)

180 Gene Product Result for
Synonyms: DUTT1 SAX3
Gene ID:
Human(6091) Summary: Bilateral symmetric nervous systems have special midline structures that establish a partition between the two mirror image halves. Some axons project toward and across the midline in response to long-range chemoattractants emanating from the midline. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Mouse(19876) roundabout homolog 1 (Drosophila)
Rat(58946) roundabout, axon guidance receptor, homolog 1 (Drosophila)
Zebrafish(30769) roundabout homolog 1
Horse(100069075) roundabout, axon guidance receptor, homolog 1 (Drosophila)
domestic cat(101093131) roundabout, axon guidance receptor, homolog 1 (Drosophila)
chicken(395292) roundabout, axon guidance receptor, homolog 1 (Drosophila)
dog(487690) roundabout, axon guidance receptor, homolog 1 (Drosophila)
domestic guinea pig(100733124) roundabout, axon guidance receptor, homolog 1 (Drosophila)
Domestic Rabbit(100344245) roundabout, axon guidance receptor, homolog 1 (Drosophila)
naked mole-rat(101713238) roundabout, axon guidance receptor, homolog 1 (Drosophila)
cow(536815) roundabout, axon guidance receptor, homolog 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0911 Rat Robo1 / Roundabout Homolog 1 ELISA Kit rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019413 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019413 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019413 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002941 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002941 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002941 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002941 Rosetta Predictions human pricing
NM_133631 Rosetta Predictions human pricing
NM_022188 Rosetta Predictions rat pricing
NM_019413 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101727 predicted 3923
2 SASI_Hs01_00101729 predicted 4342
3 SASI_Hs02_00334782 predicted 2958
4 SASI_Hs01_00101730 predicted 1918
5 SASI_Hs01_00101731 predicted 2719
6 SASI_Hs01_00101732 predicted 5039
7 SASI_Hs01_00101733 predicted 414
8 SASI_Hs02_00334783 predicted 1531
9 SASI_Hs02_00334784 predicted 4739
10 SASI_Hs01_00101734 predicted 3814
11 SASI_Hs01_00101728 predicted 3673
12 SASI_Hs01_00101735 predicted 4728
13 SASI_Hs01_00101736 predicted 2093
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129946 predicted 4766
2 SASI_Hs01_00129948 predicted 5186
3 SASI_Hs02_00363260 predicted 3801
4 SASI_Hs01_00129949 predicted 2765
5 SASI_Hs01_00129950 predicted 3561
6 SASI_Hs01_00129951 predicted 5892
7 SASI_Hs01_00129952 predicted 1257
8 SASI_Hs02_00363261 predicted 2376
9 SASI_Hs02_00363262 predicted 5584
10 SASI_Hs01_00129953 predicted 4660
11 SASI_Hs01_00129947 predicted 4523
12 SASI_Hs01_00129954 predicted 5571
13 SASI_Hs01_00129955 predicted 2931
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022188 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262934 predicted 4130
2 SASI_Rn01_00056384 predicted 2236
3 SASI_Rn01_00056385 predicted 976
4 SASI_Rn01_00056387 predicted 4030
5 SASI_Rn01_00056388 predicted 2746
6 SASI_Rn01_00056389 predicted 905
7 SASI_Rn01_00056390 predicted 2732
8 SASI_Rn01_00056391 predicted 2095
9 SASI_Rn01_00056392 predicted 1623
10 SASI_Rn01_00056393 predicted 323
11 SASI_Rn01_00056386 predicted 1926
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019413 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092981 predicted 3476
2 SASI_Mm01_00092982 predicted 3466
3 SASI_Mm01_00092983 predicted 5732
4 SASI_Mm01_00092984 predicted 3108
5 SASI_Mm02_00324336 predicted 1400
6 SASI_Mm02_00324337 predicted 3334
7 SASI_Mm01_00092985 predicted 2732
8 SASI_Mm01_00092986 predicted 5120
9 SASI_Mm01_00092987 predicted 4236
10 SASI_Mm01_00092988 predicted 4204
11 SASI_Mm01_00092989 predicted 2887
12 SASI_Mm01_00092990 predicted 2858
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019413
VALIDATED
ROBO1 MISSION shRNA Bacterial Glycerol Stock
roundabout, axon guidance receptor, homolog 1 (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019413.2-3481s21c1
Sequence:CCGGCCAGTTAGATTCTCACGGAAACTCGAGTTTCCGTGAGAATCTAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019413.2-5742s21c1
Sequence:CCGGGCCGAAGGAATATGGCAGAAACTCGAGTTTCTGCCATATTCCTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019413.2-6665s21c1
Sequence:CCGGCCCTATCTTAACTGGCCTAAACTCGAGTTTAGGCCAGTTAAGATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019413.2-1921s21c1
Sequence:CCGGGCCGCCACATTTCGTTGTAAACTCGAGTTTACAACGAAATGTGGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019413.1-5004s1c1
Sequence:CCGGGCCGAAGGAATATGGCAGAAACTCGAGTTTCTGCCATATTCCTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019413.1-1183s1c1
Sequence:CCGGGCCGCCACATTTCGTTGTAAACTCGAGTTTACAACGAAATGTGGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019413.1-765s1c1
Sequence:CCGGCCCTGGATGATAAAGATGAAACTCGAGTTTCATCTTTATCATCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100065    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019413.1-5927s1c1
Sequence:CCGGCCCTATCTTAACTGGCCTAAACTCGAGTTTAGGCCAGTTAAGATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019413.1-2743s1c1
Sequence:CCGGCCAGTTAGATTCTCACGGAAACTCGAGTTTCCGTGAGAATCTAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019413
VALIDATED
ROBO1 MISSION shRNA shRNA Plasmid DNA
roundabout, axon guidance receptor, homolog 1 (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019413.2-3481s21c1
Sequence:CCGGCCAGTTAGATTCTCACGGAAACTCGAGTTTCCGTGAGAATCTAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019413.2-5742s21c1
Sequence:CCGGGCCGAAGGAATATGGCAGAAACTCGAGTTTCTGCCATATTCCTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019413.2-6665s21c1
Sequence:CCGGCCCTATCTTAACTGGCCTAAACTCGAGTTTAGGCCAGTTAAGATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019413.2-1921s21c1
Sequence:CCGGGCCGCCACATTTCGTTGTAAACTCGAGTTTACAACGAAATGTGGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019413.1-5004s1c1
Sequence:CCGGGCCGAAGGAATATGGCAGAAACTCGAGTTTCTGCCATATTCCTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019413.1-1183s1c1
Sequence:CCGGGCCGCCACATTTCGTTGTAAACTCGAGTTTACAACGAAATGTGGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019413.1-765s1c1
Sequence:CCGGCCCTGGATGATAAAGATGAAACTCGAGTTTCATCTTTATCATCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100065    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019413.1-5927s1c1
Sequence:CCGGCCCTATCTTAACTGGCCTAAACTCGAGTTTAGGCCAGTTAAGATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019413.1-2743s1c1
Sequence:CCGGCCAGTTAGATTCTCACGGAAACTCGAGTTTCCGTGAGAATCTAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019413
VALIDATED
ROBO1 MISSION shRNA Lentiviral Transduction Particles
roundabout, axon guidance receptor, homolog 1 (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019413.2-3481s21c1
Sequence:CCGGCCAGTTAGATTCTCACGGAAACTCGAGTTTCCGTGAGAATCTAACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019413.2-5742s21c1
Sequence:CCGGGCCGAAGGAATATGGCAGAAACTCGAGTTTCTGCCATATTCCTTCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019413.2-6665s21c1
Sequence:CCGGCCCTATCTTAACTGGCCTAAACTCGAGTTTAGGCCAGTTAAGATAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019413.2-1921s21c1
Sequence:CCGGGCCGCCACATTTCGTTGTAAACTCGAGTTTACAACGAAATGTGGCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019413.1-5004s1c1
Sequence:CCGGGCCGAAGGAATATGGCAGAAACTCGAGTTTCTGCCATATTCCTTCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019413.1-1183s1c1
Sequence:CCGGGCCGCCACATTTCGTTGTAAACTCGAGTTTACAACGAAATGTGGCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019413.1-765s1c1
Sequence:CCGGCCCTGGATGATAAAGATGAAACTCGAGTTTCATCTTTATCATCCAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100065    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019413.1-5927s1c1
Sequence:CCGGCCCTATCTTAACTGGCCTAAACTCGAGTTTAGGCCAGTTAAGATAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019413.1-2743s1c1
Sequence:CCGGCCAGTTAGATTCTCACGGAAACTCGAGTTTCCGTGAGAATCTAACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002941
ROBO1 MISSION shRNA Bacterial Glycerol Stock
roundabout, axon guidance receptor, homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002941.3-5228s21c1
Sequence:CCGGTGACACATGACGCCAGATAAACTCGAGTTTATCTGGCGTCATGTGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002941.3-569s21c1
Sequence:CCGGTTGCTGCCGAGTGGATCTTTACTCGAGTAAAGATCCACTCGGCAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002941.3-3801s21c1
Sequence:CCGGATAGCGAAGAGTACAACATTTCTCGAGAAATGTTGTACTCTTCGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002941.3-4941s21c1
Sequence:CCGGATCTCATCCAAGAGGATATTCCTCGAGGAATATCCTCTTGGATGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002941.2-4841s1c1
Sequence:CCGGGCAGACAAAGAGAACAAGCAACTCGAGTTGCTTGTTCTCTTTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002941.3-1517s21c1
Sequence:CCGGATCATCACAAAGGCATATTTGCTCGAGCAAATATGCCTTTGTGATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002941.2-1718s1c1
Sequence:CCGGGCAGAAATACAGTCACATTATCTCGAGATAATGTGACTGTATTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002941.2-3654s1c1
Sequence:CCGGGCCACCAGCAAGGATGTATTTCTCGAGAAATACATCCTTGCTGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002941.2-597s1c1
Sequence:CCGGGCCCACCATTTCATGGAAGAACTCGAGTTCTTCCATGAAATGGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002941.2-703s1c1
Sequence:CCGGGCTGGCAAATATGTTTGTGTTCTCGAGAACACAAACATATTTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002941
ROBO1 MISSION shRNA shRNA Plasmid DNA
roundabout, axon guidance receptor, homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002941.3-5228s21c1
Sequence:CCGGTGACACATGACGCCAGATAAACTCGAGTTTATCTGGCGTCATGTGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002941.3-569s21c1
Sequence:CCGGTTGCTGCCGAGTGGATCTTTACTCGAGTAAAGATCCACTCGGCAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002941.3-3801s21c1
Sequence:CCGGATAGCGAAGAGTACAACATTTCTCGAGAAATGTTGTACTCTTCGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002941.3-4941s21c1
Sequence:CCGGATCTCATCCAAGAGGATATTCCTCGAGGAATATCCTCTTGGATGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002941.2-4841s1c1
Sequence:CCGGGCAGACAAAGAGAACAAGCAACTCGAGTTGCTTGTTCTCTTTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002941.3-1517s21c1
Sequence:CCGGATCATCACAAAGGCATATTTGCTCGAGCAAATATGCCTTTGTGATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002941.2-1718s1c1
Sequence:CCGGGCAGAAATACAGTCACATTATCTCGAGATAATGTGACTGTATTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002941.2-3654s1c1
Sequence:CCGGGCCACCAGCAAGGATGTATTTCTCGAGAAATACATCCTTGCTGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002941.2-597s1c1
Sequence:CCGGGCCCACCATTTCATGGAAGAACTCGAGTTCTTCCATGAAATGGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002941.2-703s1c1
Sequence:CCGGGCTGGCAAATATGTTTGTGTTCTCGAGAACACAAACATATTTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002941
ROBO1 MISSION shRNA Lentiviral Transduction Particles
roundabout, axon guidance receptor, homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002941.3-5228s21c1
Sequence:CCGGTGACACATGACGCCAGATAAACTCGAGTTTATCTGGCGTCATGTGTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002941.3-569s21c1
Sequence:CCGGTTGCTGCCGAGTGGATCTTTACTCGAGTAAAGATCCACTCGGCAGCAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002941.3-3801s21c1
Sequence:CCGGATAGCGAAGAGTACAACATTTCTCGAGAAATGTTGTACTCTTCGCTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002941.3-4941s21c1
Sequence:CCGGATCTCATCCAAGAGGATATTCCTCGAGGAATATCCTCTTGGATGAGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002941.2-4841s1c1
Sequence:CCGGGCAGACAAAGAGAACAAGCAACTCGAGTTGCTTGTTCTCTTTGTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002941.3-1517s21c1
Sequence:CCGGATCATCACAAAGGCATATTTGCTCGAGCAAATATGCCTTTGTGATGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002941.2-1718s1c1
Sequence:CCGGGCAGAAATACAGTCACATTATCTCGAGATAATGTGACTGTATTTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002941.2-3654s1c1
Sequence:CCGGGCCACCAGCAAGGATGTATTTCTCGAGAAATACATCCTTGCTGGTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002941.2-597s1c1
Sequence:CCGGGCCCACCATTTCATGGAAGAACTCGAGTTCTTCCATGAAATGGTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002941.2-703s1c1
Sequence:CCGGGCTGGCAAATATGTTTGTGTTCTCGAGAACACAAACATATTTGCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)