EMAIL THIS PAGE TO A FRIEND

ROBO4

roundabout, axon guidance receptor, homolog 4 (Drosophila)

53 Gene Product Result for
Synonyms: ECSM4 MRB
Gene ID:
Mouse(74144) roundabout homolog 4 (Drosophila)
Rat(300518) roundabout, axon guidance receptor, homolog 4 (Drosophila)
cow(783785) roundabout homolog 4, magic roundabout (Drosophila)
sheep(101108966) roundabout, axon guidance receptor, homolog 4 (Drosophila)
Domestic Rabbit(100342004) roundabout, axon guidance receptor, homolog 4 (Drosophila)
naked mole-rat(101723629) roundabout, axon guidance receptor, homolog 4 (Drosophila)
domestic guinea pig(100721256) roundabout, axon guidance receptor, homolog 4 (Drosophila)
Zebrafish(560765) roundabout homolog 4
chicken(768724) roundabout, axon guidance receptor, homolog 4 (Drosophila)
dog(489306) roundabout, axon guidance receptor, homolog 4 (Drosophila)
domestic cat(101084985) roundabout, axon guidance receptor, homolog 4 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019055 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019055 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019055 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028783 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028783 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028783 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019055 Rosetta Predictions human pricing
NM_181375 Rosetta Predictions rat pricing
NM_028783 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019055 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049614 predicted 1282
2 SASI_Hs01_00049615 predicted 3128
3 SASI_Hs01_00049616 predicted 3223
4 SASI_Hs01_00049617 predicted 1023
5 SASI_Hs01_00049618 predicted 3013
6 SASI_Hs01_00049620 predicted 1290
7 SASI_Hs01_00049621 predicted 1130
8 SASI_Hs01_00049622 predicted 3225
9 SASI_Hs01_00049623 predicted 1646
10 SASI_Hs02_00352635 predicted 391
11 SASI_Hs01_00049619 predicted 1158
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181375 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035171 predicted 2230
2 SASI_Rn01_00035172 predicted 331
3 SASI_Rn01_00035173 predicted 1089
4 SASI_Rn01_00035174 predicted 256
5 SASI_Rn01_00035175 predicted 2535
6 SASI_Rn01_00035176 predicted 746
7 SASI_Rn01_00035177 predicted 1420
8 SASI_Rn01_00035178 predicted 731
9 SASI_Rn01_00035179 predicted 2147
10 SASI_Rn02_00269708 predicted 208
11 SASI_Rn01_00035180 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028783 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161002 predicted 2511
2 SASI_Mm01_00161003 predicted 333
3 SASI_Mm01_00161004 predicted 2520
4 SASI_Mm01_00161005 predicted 456
5 SASI_Mm01_00161006 predicted 2067
6 SASI_Mm01_00161008 predicted 1488
7 SASI_Mm01_00161009 predicted 1660
8 SASI_Mm01_00161010 predicted 731
9 SASI_Mm01_00161011 predicted 299
10 SASI_Mm02_00334389 predicted 2774
11 SASI_Mm01_00161007 predicted 990
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019055
ROBO4 MISSION shRNA Bacterial Glycerol Stock
roundabout, axon guidance receptor, homolog 4 (Drosophila)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019055.4-900s1c1
Sequence:CCGGCCAATCTTACACGGCCTTGTTCTCGAGAACAAGGCCGTGTAAGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019055.4-2180s1c1
Sequence:CCGGGCTCCTCAAATGAGCTGGTTACTCGAGTAACCAGCTCATTTGAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019055.4-521s1c1
Sequence:CCGGGTGAGCAGTTTACTCTGGAATCTCGAGATTCCAGAGTAAACTGCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019055.4-2852s1c1
Sequence:CCGGGCGTCTTCATAGATGCCTCATCTCGAGATGAGGCATCTATGAAGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019055.5-3108s21c1
Sequence:CCGGAGTCAGCTCCACTGTCGTATGCTCGAGCATACGACAGTGGAGCTGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019055.5-3296s21c1
Sequence:CCGGAGAGTTCTCCCTCCACGATTGCTCGAGCAATCGTGGAGGGAGAACTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019055.5-1355s21c1
Sequence:CCGGGCTGGAAATCGCCACCCATATCTCGAGATATGGGTGGCGATTTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019055.5-1087s21c1
Sequence:CCGGGCCAAGACTACGAGTTCAAAGCTCGAGCTTTGAACTCGTAGTCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019055
ROBO4 MISSION shRNA shRNA Plasmid DNA
roundabout, axon guidance receptor, homolog 4 (Drosophila)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019055.4-900s1c1
Sequence:CCGGCCAATCTTACACGGCCTTGTTCTCGAGAACAAGGCCGTGTAAGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019055.4-2180s1c1
Sequence:CCGGGCTCCTCAAATGAGCTGGTTACTCGAGTAACCAGCTCATTTGAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019055.4-521s1c1
Sequence:CCGGGTGAGCAGTTTACTCTGGAATCTCGAGATTCCAGAGTAAACTGCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019055.4-2852s1c1
Sequence:CCGGGCGTCTTCATAGATGCCTCATCTCGAGATGAGGCATCTATGAAGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019055.5-3108s21c1
Sequence:CCGGAGTCAGCTCCACTGTCGTATGCTCGAGCATACGACAGTGGAGCTGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019055.5-3296s21c1
Sequence:CCGGAGAGTTCTCCCTCCACGATTGCTCGAGCAATCGTGGAGGGAGAACTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019055.5-1355s21c1
Sequence:CCGGGCTGGAAATCGCCACCCATATCTCGAGATATGGGTGGCGATTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019055.5-1087s21c1
Sequence:CCGGGCCAAGACTACGAGTTCAAAGCTCGAGCTTTGAACTCGTAGTCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019055
ROBO4 MISSION shRNA Lentiviral Transduction Particles
roundabout, axon guidance receptor, homolog 4 (Drosophila)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019055.4-900s1c1
Sequence:CCGGCCAATCTTACACGGCCTTGTTCTCGAGAACAAGGCCGTGTAAGATTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019055.4-2180s1c1
Sequence:CCGGGCTCCTCAAATGAGCTGGTTACTCGAGTAACCAGCTCATTTGAGGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019055.4-521s1c1
Sequence:CCGGGTGAGCAGTTTACTCTGGAATCTCGAGATTCCAGAGTAAACTGCTCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019055.4-2852s1c1
Sequence:CCGGGCGTCTTCATAGATGCCTCATCTCGAGATGAGGCATCTATGAAGACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019055.5-3108s21c1
Sequence:CCGGAGTCAGCTCCACTGTCGTATGCTCGAGCATACGACAGTGGAGCTGACTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019055.5-3296s21c1
Sequence:CCGGAGAGTTCTCCCTCCACGATTGCTCGAGCAATCGTGGAGGGAGAACTCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019055.5-1355s21c1
Sequence:CCGGGCTGGAAATCGCCACCCATATCTCGAGATATGGGTGGCGATTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019055.5-1087s21c1
Sequence:CCGGGCCAAGACTACGAGTTCAAAGCTCGAGCTTTGAACTCGTAGTCTTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028783
ROBO4 MISSION shRNA Bacterial Glycerol Stock
roundabout, axon guidance receptor, homolog 4 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028783.2-2514s1c1
Sequence:CCGGGCCAACAACCTATGGCTATATCTCGAGATATAGCCATAGGTTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028783.2-664s1c1
Sequence:CCGGGCCACCAACAATGCTGGGCAACTCGAGTTGCCCAGCATTGTTGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028783.2-1147s1c1
Sequence:CCGGCCACCTGCTGAAAGCCATAATCTCGAGATTATGGCTTTCAGCAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028783.2-2818s1c1
Sequence:CCGGGCTGACTGTGTCTTCACTGATCTCGAGATCAGTGAAGACACAGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121032    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028783.2-3183s1c1
Sequence:CCGGGCTCTGTCATTGGGATTGTTACTCGAGTAACAATCCCAATGACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028783
ROBO4 MISSION shRNA shRNA Plasmid DNA
roundabout, axon guidance receptor, homolog 4 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028783.2-2514s1c1
Sequence:CCGGGCCAACAACCTATGGCTATATCTCGAGATATAGCCATAGGTTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028783.2-664s1c1
Sequence:CCGGGCCACCAACAATGCTGGGCAACTCGAGTTGCCCAGCATTGTTGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028783.2-1147s1c1
Sequence:CCGGCCACCTGCTGAAAGCCATAATCTCGAGATTATGGCTTTCAGCAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028783.2-2818s1c1
Sequence:CCGGGCTGACTGTGTCTTCACTGATCTCGAGATCAGTGAAGACACAGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121032    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028783.2-3183s1c1
Sequence:CCGGGCTCTGTCATTGGGATTGTTACTCGAGTAACAATCCCAATGACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028783
ROBO4 MISSION shRNA Lentiviral Transduction Particles
roundabout, axon guidance receptor, homolog 4 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028783.2-2514s1c1
Sequence:CCGGGCCAACAACCTATGGCTATATCTCGAGATATAGCCATAGGTTGTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028783.2-664s1c1
Sequence:CCGGGCCACCAACAATGCTGGGCAACTCGAGTTGCCCAGCATTGTTGGTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028783.2-1147s1c1
Sequence:CCGGCCACCTGCTGAAAGCCATAATCTCGAGATTATGGCTTTCAGCAGGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028783.2-2818s1c1
Sequence:CCGGGCTGACTGTGTCTTCACTGATCTCGAGATCAGTGAAGACACAGTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121032    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028783.2-3183s1c1
Sequence:CCGGGCTCTGTCATTGGGATTGTTACTCGAGTAACAATCCCAATGACAGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)