EMAIL THIS PAGE TO A FRIEND

ROCK1

Rho-associated, coiled-coil containing protein kinase 1

194 Gene Product Result for
Synonyms: P160ROCK ROCK-I
UniProtKB ID: Q13464, B0YJ91, Q2KHM4, Q59GZ4
Gene ID:
Human(6093) Summary: This gene encodes a protein serine/threonine kinase that is activated when bound to the GTP-bound form of Rho. The small GTPase Rho regulates formation of focal adhesions and stress fibers of fibroblasts, as well as adhesion and aggregation of platelets and lymphocytes by shuttling between the inactive GDP-bound form and the active GTP-bound form. Rho is also essential in cytokinesis and plays a role in transcriptional activation by serum response factor. This protein, a downstream effector of Rho, phosphorylates and activates LIM kinase, which in turn, phosphorylates cofilin, inhibiting its actin-depolymerizing activity. [provided by RefSeq, Jul 2008]
Mouse(19877) Rho-associated coiled-coil containing protein kinase 1
Rat(81762) Rho-associated coiled-coil containing protein kinase 1
Zebrafish(100329779) Rho-associated, coiled-coil containing protein kinase 1
dog(480181) Rho-associated, coiled-coil containing protein kinase 1
Horse(100034056) Rho-associated, coiled-coil containing protein kinase 1
chicken(373970) Rho-associated, coiled-coil containing protein kinase 1
domestic guinea pig(100718968) Rho-associated, coiled-coil containing protein kinase 1
naked mole-rat(101710589) Rho-associated, coiled-coil containing protein kinase 1
Domestic Rabbit(100009220) Rho-associated, coiled-coil containing protein kinase 1
cow(785911) Rho-associated, coiled-coil containing protein kinase 1
sheep(100294662) Rho-associated, coiled-coil containing protein kinase 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
R6028 Anti-ROCK-1 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, rat, mouse
immunoprecipitation (IP), microarray, western blot pricing
HPA045639 Anti-ROCK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
MABS811 Anti-ROCK1, clone 1H4 Antibody Anti-ROCK1, clone 1H4 Antibody is an antibody against ROCK1 for use in Western Blotting, ELISA. ELISA, ELISA: suitable, western blot, western blot: suitable pricing
WH0006093M1 Monoclonal Anti-ROCK1 antibody produced in mouse clone 2E2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB5300386 Monoclonal Anti-ROCK1 antibody produced in mouse clone 1H4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
14-451-M ROKα/ROCK-II Protein, active, 10 µg activity assay, activity assay: suitable (kinase) pricing
14-338 ROKα/ROCK-II Protein, active, rat, 10 µg Active, rat, N-terminal, His-tagged, fusion protein corresponding to amino acids 2-543 of rat ROKa/ROCK-II. For use in Kinase Assays. activity assay, activity assay: suitable (kinase) pricing
14-601-M ROKβ/ROCK-I Protein, active, 10 µg Active, N-terminal His6-tagged, recombinant, human ROCK-I amino acids 17-535, autoactivated by incubating with Mg/ATP & redialysed to remove excess ATP. For use in Kinase Assays. activity assay, activity assay: suitable (kinase) pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
Y0503 Y-27632 dihydrochloride ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009071 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009071 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009071 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005406 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005406 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005406 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005406 siRNAs that have been validated in the lab human pricing
NM_031098 Rosetta Predictions rat pricing
NM_009071 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005406 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065570 validated 3010
1 SASI_Hs01_00065571 validated 1164
1 SASI_Hs01_00065573 validated 2693
2 SASI_Hs02_00339530 predicted 1896
3 SASI_Hs01_00065572 predicted 1173
4 SASI_Hs01_00065574 predicted 4449
5 SASI_Hs01_00065576 predicted 4228
6 SASI_Hs02_00339531 predicted 2533
7 SASI_Hs01_00065579 predicted 1385
8 SASI_Hs02_00339532 predicted 1202
9 SASI_Hs01_00065575 predicted 1310
10 SASI_Hs01_00065577 predicted 2054
11 SASI_Hs01_00065578 predicted 3172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031098 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050635 predicted 3485
2 SASI_Rn01_00050636 predicted 2368
3 SASI_Rn01_00050637 predicted 3533
4 SASI_Rn02_00264347 predicted 3644
5 SASI_Rn02_00264348 predicted 1418
6 SASI_Rn01_00050640 predicted 337
7 SASI_Rn01_00050641 predicted 2445
8 SASI_Rn01_00050643 predicted 4033
9 SASI_Rn02_00264349 predicted 4256
10 SASI_Rn02_00264350 predicted 3625
11 SASI_Rn01_00050634 predicted 3450
12 SASI_Rn01_00050638 predicted 2190
13 SASI_Rn01_00050639 predicted 1736
14 SASI_Rn01_00050642 predicted 1584
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009071 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077172 predicted 699
2 SASI_Mm01_00077173 predicted 2727
3 SASI_Mm02_00315255 predicted 3889
4 SASI_Mm01_00077174 predicted 2021
5 SASI_Mm02_00315256 predicted 4350
6 SASI_Mm01_00077176 predicted 3849
7 SASI_Mm01_00077177 predicted 2116
8 SASI_Mm01_00077178 predicted 1789
9 SASI_Mm02_00315257 predicted 4177
10 SASI_Mm01_00077179 predicted 2561
11 SASI_Mm01_00077171 predicted 714
12 SASI_Mm01_00077175 predicted 3501
13 SASI_Mm01_00077180 predicted 1472
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009071
VALIDATED
ROCK1 MISSION shRNA Bacterial Glycerol Stock
Rho-associated, coiled-coil containing protein kinase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009071.2-634s21c1
Sequence:CCGGCAACTTTCTAAGCAGATATAACTCGAGTTATATCTGCTTAGAAAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009071.2-4762s21c1
Sequence:CCGGCTACAGGTAGATTAGATTAATCTCGAGATTAATCTAATCTACCTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009071.2-4570s21c1
Sequence:CCGGTGTGGGATGCTACCTGATAAACTCGAGTTTATCAGGTAGCATCCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009071.2-3717s21c1
Sequence:CCGGCTAGCAAAGAGAGTGATATTGCTCGAGCAATATCACTCTCTTTGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009071.2-744s21c1
Sequence:CCGGTTCAATTGGTGAGGCATAAATCTCGAGATTTATGCCTCACCAATTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009071.1-3019s1c1
Sequence:CCGGGCAGAAATAATGAATCGCAAACTCGAGTTTGCGATTCATTATTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009071.1-1438s1c1
Sequence:CCGGGCAGTGTCTCAAATTGAGAAACTCGAGTTTCTCAATTTGAGACACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009071.1-3844s1c1
Sequence:CCGGCCGTGCAAAGTAAGTTACGATCTCGAGATCGTAACTTACTTTGCACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009071.1-108s1c1
Sequence:CCGGCCTGGTTTATGATTTGGATTTCTCGAGAAATCCAAATCATAAACCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009071
VALIDATED
ROCK1 MISSION shRNA shRNA Plasmid DNA
Rho-associated, coiled-coil containing protein kinase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009071.2-634s21c1
Sequence:CCGGCAACTTTCTAAGCAGATATAACTCGAGTTATATCTGCTTAGAAAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009071.2-4762s21c1
Sequence:CCGGCTACAGGTAGATTAGATTAATCTCGAGATTAATCTAATCTACCTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009071.2-4570s21c1
Sequence:CCGGTGTGGGATGCTACCTGATAAACTCGAGTTTATCAGGTAGCATCCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009071.2-3717s21c1
Sequence:CCGGCTAGCAAAGAGAGTGATATTGCTCGAGCAATATCACTCTCTTTGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009071.2-744s21c1
Sequence:CCGGTTCAATTGGTGAGGCATAAATCTCGAGATTTATGCCTCACCAATTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009071.1-3019s1c1
Sequence:CCGGGCAGAAATAATGAATCGCAAACTCGAGTTTGCGATTCATTATTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009071.1-1438s1c1
Sequence:CCGGGCAGTGTCTCAAATTGAGAAACTCGAGTTTCTCAATTTGAGACACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009071.1-3844s1c1
Sequence:CCGGCCGTGCAAAGTAAGTTACGATCTCGAGATCGTAACTTACTTTGCACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009071.1-108s1c1
Sequence:CCGGCCTGGTTTATGATTTGGATTTCTCGAGAAATCCAAATCATAAACCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009071
VALIDATED
ROCK1 MISSION shRNA Lentiviral Transduction Particles
Rho-associated, coiled-coil containing protein kinase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009071.2-634s21c1
Sequence:CCGGCAACTTTCTAAGCAGATATAACTCGAGTTATATCTGCTTAGAAAGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009071.2-4762s21c1
Sequence:CCGGCTACAGGTAGATTAGATTAATCTCGAGATTAATCTAATCTACCTGTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009071.2-4570s21c1
Sequence:CCGGTGTGGGATGCTACCTGATAAACTCGAGTTTATCAGGTAGCATCCCACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009071.2-3717s21c1
Sequence:CCGGCTAGCAAAGAGAGTGATATTGCTCGAGCAATATCACTCTCTTTGCTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009071.2-744s21c1
Sequence:CCGGTTCAATTGGTGAGGCATAAATCTCGAGATTTATGCCTCACCAATTGAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009071.1-3019s1c1
Sequence:CCGGGCAGAAATAATGAATCGCAAACTCGAGTTTGCGATTCATTATTTCTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009071.1-1438s1c1
Sequence:CCGGGCAGTGTCTCAAATTGAGAAACTCGAGTTTCTCAATTTGAGACACTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009071.1-3844s1c1
Sequence:CCGGCCGTGCAAAGTAAGTTACGATCTCGAGATCGTAACTTACTTTGCACGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009071.1-108s1c1
Sequence:CCGGCCTGGTTTATGATTTGGATTTCTCGAGAAATCCAAATCATAAACCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005406
VALIDATED
ROCK1 MISSION shRNA Bacterial Glycerol Stock
Rho-associated, coiled-coil containing protein kinase 1
Human
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.2-2144s1c1
Sequence:CCGGCAATCGTAGATACTTATCTTCCTCGAGGAAGATAAGTATCTACGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005406.2-4954s1c1
Sequence:CCGGCAAATCAGTCTTTCCGGAAAGCTCGAGCTTTCCGGAAAGACTGATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.2-3514s1c1
Sequence:CCGGCCCAGGTAAAGGAACTTAAAGCTCGAGCTTTAAGTTCCTTTACCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.2-6373s1c1
Sequence:CCGGCGATCGTCTCTAGGATGATATCTCGAGATATCATCCTAGAGACGATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005406.2-6464s1c1
Sequence:CCGGCTAATGACTCTGTGCTCATTTCTCGAGAAATGAGCACAGAGTCATTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.1-1057s1c1
Sequence:CCGGGCACCAGTTGTACCCGATTTACTCGAGTAAATCGGGTACAACTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.x-1069s1c1
Sequence:CCGGCCCGATTTAAGTAGTGACATTCTCGAGAATGTCACTACTTAAATCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.x-3241s1c1
Sequence:CCGGGCCAGCAAAGAGAGTGATATTCTCGAGAATATCACTCTCTTTGCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005406.x-3377s1c1
Sequence:CCGGCAGTACCAAATAGAGGAAATACTCGAGTATTTCCTCTATTTGGTACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.x-1885s1c1
Sequence:CCGGGCTCGAATTACATCTTTACAACTCGAGTTGTAAAGATGTAATTCGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.1-526s1c1
Sequence:CCGGCGATTCTATACTGCAGAAGTACTCGAGTACTTCTGCAGTATAGAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.1-2047s1c1
Sequence:CCGGCGGTTAGAACAAGAGGTAAATCTCGAGATTTACCTCTTGTTCTAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.1-3490s1c1
Sequence:CCGGCCATCTATGGTATTGGACATACTCGAGTATGTCCAATACCATAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.1-424s1c1
Sequence:CCGGGCATTCCAAGATGATCGTTATCTCGAGATAACGATCATCTTGGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.1-2305s1c1
Sequence:CCGGGTTAAGAATCTAACCCTGCAACTCGAGTTGCAGGGTTAGATTCTTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.1-3293s1c1
Sequence:CCGGCGGATTCTACAAGTGTTGCTACTCGAGTAGCAACACTTGTAGAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.1-2932s1c1
Sequence:CCGGGAGGAGGAGATCAGTAATCTTCTCGAGAAGATTACTGATCTCCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.x-2059s1c1
Sequence:CCGGGAGGTAAATGAACACAAAGTACTCGAGTACTTTGTGTTCATTTACCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.2-1414s1c1
Sequence:CCGGGTGGAGATCTTGTAAACTTAACTCGAGTTAAGTTTACAAGATCTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005406
VALIDATED
ROCK1 MISSION shRNA shRNA Plasmid DNA
Rho-associated, coiled-coil containing protein kinase 1
Human
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.2-2144s1c1
Sequence:CCGGCAATCGTAGATACTTATCTTCCTCGAGGAAGATAAGTATCTACGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005406.2-4954s1c1
Sequence:CCGGCAAATCAGTCTTTCCGGAAAGCTCGAGCTTTCCGGAAAGACTGATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.2-3514s1c1
Sequence:CCGGCCCAGGTAAAGGAACTTAAAGCTCGAGCTTTAAGTTCCTTTACCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.2-6373s1c1
Sequence:CCGGCGATCGTCTCTAGGATGATATCTCGAGATATCATCCTAGAGACGATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005406.2-6464s1c1
Sequence:CCGGCTAATGACTCTGTGCTCATTTCTCGAGAAATGAGCACAGAGTCATTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.1-1057s1c1
Sequence:CCGGGCACCAGTTGTACCCGATTTACTCGAGTAAATCGGGTACAACTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.x-1069s1c1
Sequence:CCGGCCCGATTTAAGTAGTGACATTCTCGAGAATGTCACTACTTAAATCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.x-3241s1c1
Sequence:CCGGGCCAGCAAAGAGAGTGATATTCTCGAGAATATCACTCTCTTTGCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005406.x-3377s1c1
Sequence:CCGGCAGTACCAAATAGAGGAAATACTCGAGTATTTCCTCTATTTGGTACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.x-1885s1c1
Sequence:CCGGGCTCGAATTACATCTTTACAACTCGAGTTGTAAAGATGTAATTCGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.1-526s1c1
Sequence:CCGGCGATTCTATACTGCAGAAGTACTCGAGTACTTCTGCAGTATAGAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.1-2047s1c1
Sequence:CCGGCGGTTAGAACAAGAGGTAAATCTCGAGATTTACCTCTTGTTCTAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.1-3490s1c1
Sequence:CCGGCCATCTATGGTATTGGACATACTCGAGTATGTCCAATACCATAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.1-424s1c1
Sequence:CCGGGCATTCCAAGATGATCGTTATCTCGAGATAACGATCATCTTGGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.1-2305s1c1
Sequence:CCGGGTTAAGAATCTAACCCTGCAACTCGAGTTGCAGGGTTAGATTCTTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.1-3293s1c1
Sequence:CCGGCGGATTCTACAAGTGTTGCTACTCGAGTAGCAACACTTGTAGAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.1-2932s1c1
Sequence:CCGGGAGGAGGAGATCAGTAATCTTCTCGAGAAGATTACTGATCTCCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.x-2059s1c1
Sequence:CCGGGAGGTAAATGAACACAAAGTACTCGAGTACTTTGTGTTCATTTACCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.2-1414s1c1
Sequence:CCGGGTGGAGATCTTGTAAACTTAACTCGAGTTAAGTTTACAAGATCTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005406
VALIDATED
ROCK1 MISSION shRNA Lentiviral Transduction Particles
Rho-associated, coiled-coil containing protein kinase 1
Human
19 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.2-2144s1c1
Sequence:CCGGCAATCGTAGATACTTATCTTCCTCGAGGAAGATAAGTATCTACGATTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005406.2-4954s1c1
Sequence:CCGGCAAATCAGTCTTTCCGGAAAGCTCGAGCTTTCCGGAAAGACTGATTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.2-3514s1c1
Sequence:CCGGCCCAGGTAAAGGAACTTAAAGCTCGAGCTTTAAGTTCCTTTACCTGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.2-6373s1c1
Sequence:CCGGCGATCGTCTCTAGGATGATATCTCGAGATATCATCCTAGAGACGATCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005406.2-6464s1c1
Sequence:CCGGCTAATGACTCTGTGCTCATTTCTCGAGAAATGAGCACAGAGTCATTAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.1-1057s1c1
Sequence:CCGGGCACCAGTTGTACCCGATTTACTCGAGTAAATCGGGTACAACTGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.x-1069s1c1
Sequence:CCGGCCCGATTTAAGTAGTGACATTCTCGAGAATGTCACTACTTAAATCGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.x-3241s1c1
Sequence:CCGGGCCAGCAAAGAGAGTGATATTCTCGAGAATATCACTCTCTTTGCTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005406.x-3377s1c1
Sequence:CCGGCAGTACCAAATAGAGGAAATACTCGAGTATTTCCTCTATTTGGTACTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.x-1885s1c1
Sequence:CCGGGCTCGAATTACATCTTTACAACTCGAGTTGTAAAGATGTAATTCGAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.1-526s1c1
Sequence:CCGGCGATTCTATACTGCAGAAGTACTCGAGTACTTCTGCAGTATAGAATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.1-2047s1c1
Sequence:CCGGCGGTTAGAACAAGAGGTAAATCTCGAGATTTACCTCTTGTTCTAACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.1-3490s1c1
Sequence:CCGGCCATCTATGGTATTGGACATACTCGAGTATGTCCAATACCATAGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.1-424s1c1
Sequence:CCGGGCATTCCAAGATGATCGTTATCTCGAGATAACGATCATCTTGGAATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.1-2305s1c1
Sequence:CCGGGTTAAGAATCTAACCCTGCAACTCGAGTTGCAGGGTTAGATTCTTAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.1-3293s1c1
Sequence:CCGGCGGATTCTACAAGTGTTGCTACTCGAGTAGCAACACTTGTAGAATCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.1-2932s1c1
Sequence:CCGGGAGGAGGAGATCAGTAATCTTCTCGAGAAGATTACTGATCTCCTCCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.x-2059s1c1
Sequence:CCGGGAGGTAAATGAACACAAAGTACTCGAGTACTTTGTGTTCATTTACCTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005406.2-1414s1c1
Sequence:CCGGGTGGAGATCTTGTAAACTTAACTCGAGTTAAGTTTACAAGATCTCCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)