EMAIL THIS PAGE TO A FRIEND

ROCK2

Rho-associated, coiled-coil containing protein kinase 2

162 Gene Product Result for
Synonyms: ROCK-II
UniProtKB ID: O75116, Q53QZ0, Q53SJ7, Q9UQN5
Gene ID:
Human(9475) Summary: The protein encoded by this gene is a serine/threonine kinase that regulates cytokinesis, smooth muscle contraction, the formation of actin stress fibers and focal adhesions, and the activation of the c-fos serum response element. This protein, which is an isozyme of ROCK1 is a target for the small GTPase Rho. [provided by RefSeq, Jul 2008]
Mouse(19878) Rho-associated coiled-coil containing protein kinase 2
Rat(25537) Rho-associated coiled-coil containing protein kinase 2
chicken(374182) Rho-associated, coiled-coil containing protein kinase 2
dog(482970) Rho-associated, coiled-coil containing protein kinase 2
domestic cat(101094501) Rho-associated, coiled-coil containing protein kinase 2
cow(282041) Rho-associated, coiled-coil containing protein kinase 2
sheep(101103800) Rho-associated, coiled-coil containing protein kinase 2
sheep(100294663) Rho-associated, coiled-coil containing protein kinase 2
naked mole-rat(101724195) Rho-associated, coiled-coil containing protein kinase 2
domestic guinea pig(100713798) Rho-associated, coiled-coil containing protein kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009072 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009072 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009072 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004850 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004850 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004850 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU030131 MISSION® esiRNA esiRNA human ROCK2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004850 siRNAs that have been validated in the lab human pricing
NM_013022 Rosetta Predictions rat pricing
NM_009072 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004850 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204251 validated 2456
1 SASI_Hs01_00204253 validated 2606
1 SASI_Hs01_00204252 validated 3643
2 SASI_Hs01_00204254 predicted 2792
3 SASI_Hs01_00204256 predicted 1676
4 SASI_Hs01_00204257 predicted 3340
5 SASI_Hs01_00204258 predicted 3312
6 SASI_Hs02_00338437 predicted 4332
7 SASI_Hs02_00338438 predicted 4629
8 SASI_Hs01_00204260 predicted 2513
9 SASI_Hs01_00204255 predicted 2354
10 SASI_Hs01_00204259 predicted 3951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013022 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030374 predicted 518
2 SASI_Rn01_00030375 predicted 2395
3 SASI_Rn02_00260697 predicted 1889
4 SASI_Rn01_00030378 predicted 3475
5 SASI_Rn01_00030379 predicted 1451
6 SASI_Rn02_00260698 predicted 2201
7 SASI_Rn01_00030381 predicted 4199
8 SASI_Rn01_00030382 predicted 651
9 SASI_Rn01_00030383 predicted 3631
10 SASI_Rn02_00260699 predicted 700
11 SASI_Rn01_00030376 predicted 2991
12 SASI_Rn01_00030377 predicted 679
13 SASI_Rn01_00030380 predicted 3939
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009072 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147712 predicted 855
2 SASI_Mm01_00147713 predicted 3305
3 SASI_Mm02_00315258 predicted 4419
4 SASI_Mm01_00147714 predicted 2368
5 SASI_Mm01_00147715 predicted 812
6 SASI_Mm01_00147716 predicted 3813
7 SASI_Mm01_00147717 predicted 2028
8 SASI_Mm01_00147718 predicted 884
9 SASI_Mm01_00147719 predicted 3798
10 SASI_Mm02_00315259 predicted 4377
11 SASI_Mm01_00147720 predicted 533
12 SASI_Mm01_00147721 predicted 2939
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009072
VALIDATED
ROCK2 MISSION shRNA Bacterial Glycerol Stock
Rho-associated, coiled-coil containing protein kinase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009072.2-3442s21c1
Sequence:CCGGTGACACAACAGATGATCAAATCTCGAGATTTGATCATCTGTTGTGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009072.2-826s21c1
Sequence:CCGGTACACTCCATGGGCTTAATACCTCGAGGTATTAAGCCCATGGAGTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009072.2-3243s21c1
Sequence:CCGGATGAGTGCAGCAGCTATTAAACTCGAGTTTAATAGCTGCTGCACTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009072.2-1614s21c1
Sequence:CCGGCAGAAGTGCAAATCTATTAATCTCGAGATTAATAGATTTGCACTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009072.1-3968s1c1
Sequence:CCGGCGGCAAAGAATCTATTGTTATCTCGAGATAACAATAGATTCTTTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009072.1-2742s1c1
Sequence:CCGGGCTGGAAATTACCCTTACCAACTCGAGTTGGTAAGGGTAATTTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009072.1-1904s1c1
Sequence:CCGGCCCATGGATCAGAGATAATTACTCGAGTAATTATCTCTGATCCATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009072.1-2905s1c1
Sequence:CCGGGCATCTCTTGAAGAAACAAATCTCGAGATTTGTTTCTTCAAGAGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009072.1-3940s1c1
Sequence:CCGGCCCTGCAAAGTTTATTATGATCTCGAGATCATAATAAACTTTGCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009072
VALIDATED
ROCK2 MISSION shRNA shRNA Plasmid DNA
Rho-associated, coiled-coil containing protein kinase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009072.2-3442s21c1
Sequence:CCGGTGACACAACAGATGATCAAATCTCGAGATTTGATCATCTGTTGTGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009072.2-826s21c1
Sequence:CCGGTACACTCCATGGGCTTAATACCTCGAGGTATTAAGCCCATGGAGTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009072.2-3243s21c1
Sequence:CCGGATGAGTGCAGCAGCTATTAAACTCGAGTTTAATAGCTGCTGCACTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009072.2-1614s21c1
Sequence:CCGGCAGAAGTGCAAATCTATTAATCTCGAGATTAATAGATTTGCACTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009072.1-3968s1c1
Sequence:CCGGCGGCAAAGAATCTATTGTTATCTCGAGATAACAATAGATTCTTTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009072.1-2742s1c1
Sequence:CCGGGCTGGAAATTACCCTTACCAACTCGAGTTGGTAAGGGTAATTTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009072.1-1904s1c1
Sequence:CCGGCCCATGGATCAGAGATAATTACTCGAGTAATTATCTCTGATCCATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009072.1-2905s1c1
Sequence:CCGGGCATCTCTTGAAGAAACAAATCTCGAGATTTGTTTCTTCAAGAGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009072.1-3940s1c1
Sequence:CCGGCCCTGCAAAGTTTATTATGATCTCGAGATCATAATAAACTTTGCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009072
VALIDATED
ROCK2 MISSION shRNA Lentiviral Transduction Particles
Rho-associated, coiled-coil containing protein kinase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009072.2-3442s21c1
Sequence:CCGGTGACACAACAGATGATCAAATCTCGAGATTTGATCATCTGTTGTGTCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009072.2-826s21c1
Sequence:CCGGTACACTCCATGGGCTTAATACCTCGAGGTATTAAGCCCATGGAGTGTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009072.2-3243s21c1
Sequence:CCGGATGAGTGCAGCAGCTATTAAACTCGAGTTTAATAGCTGCTGCACTCATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009072.2-1614s21c1
Sequence:CCGGCAGAAGTGCAAATCTATTAATCTCGAGATTAATAGATTTGCACTTCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009072.1-3968s1c1
Sequence:CCGGCGGCAAAGAATCTATTGTTATCTCGAGATAACAATAGATTCTTTGCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009072.1-2742s1c1
Sequence:CCGGGCTGGAAATTACCCTTACCAACTCGAGTTGGTAAGGGTAATTTCCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009072.1-1904s1c1
Sequence:CCGGCCCATGGATCAGAGATAATTACTCGAGTAATTATCTCTGATCCATGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009072.1-2905s1c1
Sequence:CCGGGCATCTCTTGAAGAAACAAATCTCGAGATTTGTTTCTTCAAGAGATGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009072.1-3940s1c1
Sequence:CCGGCCCTGCAAAGTTTATTATGATCTCGAGATCATAATAAACTTTGCAGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004850
VALIDATED
ROCK2 MISSION shRNA Bacterial Glycerol Stock
Rho-associated, coiled-coil containing protein kinase 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004850.3-5578s1c1
Sequence:CCGGCCTTGATGTCTGTCTATTATTCTCGAGAATAATAGACAGACATCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004850.3-922s1c1
Sequence:CCGGCCTTTCAAGATGATAGGTATCCTCGAGGATACCTATCATCTTGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004850.3-3765s1c1
Sequence:CCGGCAGATGACATTGGACAGTAAACTCGAGTTTACTGTCCAATGTCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004850.3-5578s21c1
Sequence:CCGGCCTTGATGTCTGTCTATTATTCTCGAGAATAATAGACAGACATCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004850.3-3501s21c1
Sequence:CCGGGCACAGTTTGAGAAGCAGCTACTCGAGTAGCTGCTTCTCAAACTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004850.3-804s21c1
Sequence:CCGGGCTATGAAGCTTCTTAGTAAGCTCGAGCTTACTAAGAAGCTTCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004850.x-5239s1c1
Sequence:CCGGCCTGTGTACCTGATGGAAGTTCTCGAGAACTTCCATCAGGTACACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004850.x-3506s1c1
Sequence:CCGGGCACAGTTTGAGAAGCAGCTACTCGAGTAGCTGCTTCTCAAACTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004850.3-583s21c1
Sequence:CCGGGCTTGCTGGATGGCTTAAATTCTCGAGAATTTAAGCCATCCAGCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004850.x-4337s1c1
Sequence:CCGGCGTTGCCATATTAAGTGTCATCTCGAGATGACACTTAATATGGCAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004850.x-3827s1c1
Sequence:CCGGGCCTTGCATATTGGTCTGGATCTCGAGATCCAGACCAATATGCAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004850.3-804s1c1
Sequence:CCGGGCTATGAAGCTTCTTAGTAAGCTCGAGCTTACTAAGAAGCTTCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004850.3-583s1c1
Sequence:CCGGGCTTGCTGGATGGCTTAAATTCTCGAGAATTTAAGCCATCCAGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004850
VALIDATED
ROCK2 MISSION shRNA shRNA Plasmid DNA
Rho-associated, coiled-coil containing protein kinase 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004850.3-5578s1c1
Sequence:CCGGCCTTGATGTCTGTCTATTATTCTCGAGAATAATAGACAGACATCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004850.3-922s1c1
Sequence:CCGGCCTTTCAAGATGATAGGTATCCTCGAGGATACCTATCATCTTGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004850.3-3765s1c1
Sequence:CCGGCAGATGACATTGGACAGTAAACTCGAGTTTACTGTCCAATGTCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004850.3-5578s21c1
Sequence:CCGGCCTTGATGTCTGTCTATTATTCTCGAGAATAATAGACAGACATCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004850.3-3501s21c1
Sequence:CCGGGCACAGTTTGAGAAGCAGCTACTCGAGTAGCTGCTTCTCAAACTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004850.3-804s21c1
Sequence:CCGGGCTATGAAGCTTCTTAGTAAGCTCGAGCTTACTAAGAAGCTTCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004850.x-5239s1c1
Sequence:CCGGCCTGTGTACCTGATGGAAGTTCTCGAGAACTTCCATCAGGTACACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004850.x-3506s1c1
Sequence:CCGGGCACAGTTTGAGAAGCAGCTACTCGAGTAGCTGCTTCTCAAACTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004850.3-583s21c1
Sequence:CCGGGCTTGCTGGATGGCTTAAATTCTCGAGAATTTAAGCCATCCAGCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004850.x-4337s1c1
Sequence:CCGGCGTTGCCATATTAAGTGTCATCTCGAGATGACACTTAATATGGCAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004850.x-3827s1c1
Sequence:CCGGGCCTTGCATATTGGTCTGGATCTCGAGATCCAGACCAATATGCAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004850.3-804s1c1
Sequence:CCGGGCTATGAAGCTTCTTAGTAAGCTCGAGCTTACTAAGAAGCTTCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004850.3-583s1c1
Sequence:CCGGGCTTGCTGGATGGCTTAAATTCTCGAGAATTTAAGCCATCCAGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004850
VALIDATED
ROCK2 MISSION shRNA Lentiviral Transduction Particles
Rho-associated, coiled-coil containing protein kinase 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004850.3-5578s1c1
Sequence:CCGGCCTTGATGTCTGTCTATTATTCTCGAGAATAATAGACAGACATCAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004850.3-922s1c1
Sequence:CCGGCCTTTCAAGATGATAGGTATCCTCGAGGATACCTATCATCTTGAAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004850.3-3765s1c1
Sequence:CCGGCAGATGACATTGGACAGTAAACTCGAGTTTACTGTCCAATGTCATCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004850.3-5578s21c1
Sequence:CCGGCCTTGATGTCTGTCTATTATTCTCGAGAATAATAGACAGACATCAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004850.3-3501s21c1
Sequence:CCGGGCACAGTTTGAGAAGCAGCTACTCGAGTAGCTGCTTCTCAAACTGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004850.3-804s21c1
Sequence:CCGGGCTATGAAGCTTCTTAGTAAGCTCGAGCTTACTAAGAAGCTTCATAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004850.x-5239s1c1
Sequence:CCGGCCTGTGTACCTGATGGAAGTTCTCGAGAACTTCCATCAGGTACACAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004850.x-3506s1c1
Sequence:CCGGGCACAGTTTGAGAAGCAGCTACTCGAGTAGCTGCTTCTCAAACTGTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004850.3-583s21c1
Sequence:CCGGGCTTGCTGGATGGCTTAAATTCTCGAGAATTTAAGCCATCCAGCAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004850.x-4337s1c1
Sequence:CCGGCGTTGCCATATTAAGTGTCATCTCGAGATGACACTTAATATGGCAACGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004850.x-3827s1c1
Sequence:CCGGGCCTTGCATATTGGTCTGGATCTCGAGATCCAGACCAATATGCAAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004850.3-804s1c1
Sequence:CCGGGCTATGAAGCTTCTTAGTAAGCTCGAGCTTACTAAGAAGCTTCATAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004850.3-583s1c1
Sequence:CCGGGCTTGCTGGATGGCTTAAATTCTCGAGAATTTAAGCCATCCAGCAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)