EMAIL THIS PAGE TO A FRIEND

ROMO1

reactive oxygen species modulator 1

51 Gene Product Result for
Synonyms: C20orf52 MTGM MTGMP bA353C18.2
Gene ID:
Mouse(67067) reactive oxygen species modulator 1
Rat(679572) reactive oxygen species modulator 1
chicken(768833) reactive oxygen species modulator 1
domestic cat(101099955) reactive oxygen species modulator 1
dog(477215) reactive oxygen species modulator 1-like
domestic guinea pig(100734339) reactive oxygen species modulator 1
naked mole-rat(101725012) reactive oxygen species modulator 1
Domestic Rabbit(100328919) reactive oxygen species modulator 1
cow(618530) reactive oxygen species modulator 1
sheep(101117865) reactive oxygen species modulator 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025946 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025946 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025946 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080748 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080748 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080748 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080748 Rosetta Predictions human pricing
XM_001053332 Rosetta Predictions rat pricing
XM_001053409 Rosetta Predictions rat pricing
NM_025946 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080748 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060468 predicted 335
2 SASI_Hs01_00060469 predicted 148
3 SASI_Hs01_00060470 predicted 336
4 SASI_Hs01_00060471 predicted 368
5 SASI_Hs01_00060472 predicted 151
6 SASI_Hs01_00060473 predicted 331
7 SASI_Hs02_00362547 predicted 372
8 SASI_Hs01_00060464 predicted 181
9 SASI_Hs02_00362548 predicted 331
10 SASI_Hs02_00362549 predicted 376
11 SASI_Hs01_00060465 predicted 208
12 SASI_Hs01_00060466 predicted 199
13 SASI_Hs01_00060467 predicted 202
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053332 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00271997 predicted 221
2 SASI_Rn02_00271998 predicted 214
3 SASI_Rn02_00271999 predicted 211
4 SASI_Rn02_00272000 predicted 263
5 SASI_Rn02_00272001 predicted 160
6 SASI_Rn02_00272002 predicted 161
7 SASI_Rn02_00272003 predicted 302
8 SASI_Rn02_00272004 predicted 297
9 SASI_Rn02_00272005 predicted 293
10 SASI_Rn02_00272006 predicted 106
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053409 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272229 predicted 174
2 SASI_Rn02_00272230 predicted 214
3 SASI_Rn02_00272231 predicted 114
4 SASI_Rn02_00272232 predicted 111
5 SASI_Rn02_00272233 predicted 250
6 SASI_Rn02_00272234 predicted 247
7 SASI_Rn02_00272235 predicted 65
8 SASI_Rn02_00272236 predicted 248
9 SASI_Rn02_00272237 predicted 247
10 SASI_Rn02_00272238 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025946 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329331 predicted 183
2 SASI_Mm02_00329332 predicted 393
3 SASI_Mm02_00329333 predicted 171
4 SASI_Mm02_00329334 predicted 268
5 SASI_Mm02_00329335 predicted 165
6 SASI_Mm02_00329336 predicted 395
7 SASI_Mm02_00329337 predicted 396
8 SASI_Mm02_00329338 predicted 337
9 SASI_Mm02_00329339 predicted 343
10 SASI_Mm02_00329340 predicted 260
11 SASI_Mm01_00052193 predicted 300
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025946
VALIDATED
ROMO1 MISSION shRNA Bacterial Glycerol Stock
reactive oxygen species modulator 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025946.2-175s1c1
Sequence:CCGGCGTGAAGATGGGCTTCGTCATCTCGAGATGACGAAGCCCATCTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025946.2-336s1c1
Sequence:CCGGCCATTGGAATGGGCATACGATCTCGAGATCGTATGCCCATTCCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025946.2-313s1c1
Sequence:CCGGCGGCACGTTTGGCACTTTCATCTCGAGATGAAAGTGCCAAACGTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025946.2-169s1c1
Sequence:CCGGCGACCGCGTGAAGATGGGCTTCTCGAGAAGCCCATCTTCACGCGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025946.2-324s1c1
Sequence:CCGGGCACTTTCATGGCCATTGGAACTCGAGTTCCAATGGCCATGAAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025946.4-307s21c1
Sequence:CCGGCGGCACGTTTGGCACTTTCATCTCGAGATGAAAGTGCCAAACGTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025946.4-345s21c1
Sequence:CCGGTACGATGCTAATTAGGGCTAGCTCGAGCTAGCCCTAATTAGCATCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025946.4-236s21c1
Sequence:CCGGTCCTGTCTCAGGATCGGAATGCTCGAGCATTCCGATCCTGAGACAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025946.4-169s21c1
Sequence:CCGGCGTGAAGATGGGCTTCGTCATCTCGAGATGACGAAGCCCATCTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025946.4-330s21c1
Sequence:CCGGCCATTGGAATGGGCATACGATCTCGAGATCGTATGCCCATTCCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025946
VALIDATED
ROMO1 MISSION shRNA shRNA Plasmid DNA
reactive oxygen species modulator 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025946.2-175s1c1
Sequence:CCGGCGTGAAGATGGGCTTCGTCATCTCGAGATGACGAAGCCCATCTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025946.2-336s1c1
Sequence:CCGGCCATTGGAATGGGCATACGATCTCGAGATCGTATGCCCATTCCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025946.2-313s1c1
Sequence:CCGGCGGCACGTTTGGCACTTTCATCTCGAGATGAAAGTGCCAAACGTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025946.2-169s1c1
Sequence:CCGGCGACCGCGTGAAGATGGGCTTCTCGAGAAGCCCATCTTCACGCGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025946.2-324s1c1
Sequence:CCGGGCACTTTCATGGCCATTGGAACTCGAGTTCCAATGGCCATGAAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025946.4-307s21c1
Sequence:CCGGCGGCACGTTTGGCACTTTCATCTCGAGATGAAAGTGCCAAACGTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025946.4-345s21c1
Sequence:CCGGTACGATGCTAATTAGGGCTAGCTCGAGCTAGCCCTAATTAGCATCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025946.4-236s21c1
Sequence:CCGGTCCTGTCTCAGGATCGGAATGCTCGAGCATTCCGATCCTGAGACAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025946.4-169s21c1
Sequence:CCGGCGTGAAGATGGGCTTCGTCATCTCGAGATGACGAAGCCCATCTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025946.4-330s21c1
Sequence:CCGGCCATTGGAATGGGCATACGATCTCGAGATCGTATGCCCATTCCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025946
VALIDATED
ROMO1 MISSION shRNA Lentiviral Transduction Particles
reactive oxygen species modulator 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025946.2-175s1c1
Sequence:CCGGCGTGAAGATGGGCTTCGTCATCTCGAGATGACGAAGCCCATCTTCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025946.2-336s1c1
Sequence:CCGGCCATTGGAATGGGCATACGATCTCGAGATCGTATGCCCATTCCAATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025946.2-313s1c1
Sequence:CCGGCGGCACGTTTGGCACTTTCATCTCGAGATGAAAGTGCCAAACGTGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025946.2-169s1c1
Sequence:CCGGCGACCGCGTGAAGATGGGCTTCTCGAGAAGCCCATCTTCACGCGGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025946.2-324s1c1
Sequence:CCGGGCACTTTCATGGCCATTGGAACTCGAGTTCCAATGGCCATGAAAGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025946.4-307s21c1
Sequence:CCGGCGGCACGTTTGGCACTTTCATCTCGAGATGAAAGTGCCAAACGTGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025946.4-345s21c1
Sequence:CCGGTACGATGCTAATTAGGGCTAGCTCGAGCTAGCCCTAATTAGCATCGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025946.4-236s21c1
Sequence:CCGGTCCTGTCTCAGGATCGGAATGCTCGAGCATTCCGATCCTGAGACAGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025946.4-169s21c1
Sequence:CCGGCGTGAAGATGGGCTTCGTCATCTCGAGATGACGAAGCCCATCTTCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025946.4-330s21c1
Sequence:CCGGCCATTGGAATGGGCATACGATCTCGAGATCGTATGCCCATTCCAATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080748
VALIDATED
ROMO1 MISSION shRNA Bacterial Glycerol Stock
reactive oxygen species modulator 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080748.2-219s21c1
Sequence:CCGGGATGGGTTGCGCCGTGGGCATCTCGAGATGCCCACGGCGCAACCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080748.2-208s21c1
Sequence:CCGGATGGGCTTCGTGATGGGTTGCCTCGAGGCAACCCATCACGAAGCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080748.2-268s21c1
Sequence:CCGGTCCTGTCTCAGGATCGGAATGCTCGAGCATTCCGATCCTGAGACAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080748.2-174s21c1
Sequence:CCGGACAGTCCCAGCCAAGCTGCTTCTCGAGAAGCAGCTTGGCTGGGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080748.2-187s21c1
Sequence:CCGGAGCTGCTTCGACCGTGTCAAACTCGAGTTTGACACGGTCGAAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080748
VALIDATED
ROMO1 MISSION shRNA shRNA Plasmid DNA
reactive oxygen species modulator 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080748.2-219s21c1
Sequence:CCGGGATGGGTTGCGCCGTGGGCATCTCGAGATGCCCACGGCGCAACCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080748.2-208s21c1
Sequence:CCGGATGGGCTTCGTGATGGGTTGCCTCGAGGCAACCCATCACGAAGCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080748.2-268s21c1
Sequence:CCGGTCCTGTCTCAGGATCGGAATGCTCGAGCATTCCGATCCTGAGACAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080748.2-174s21c1
Sequence:CCGGACAGTCCCAGCCAAGCTGCTTCTCGAGAAGCAGCTTGGCTGGGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080748.2-187s21c1
Sequence:CCGGAGCTGCTTCGACCGTGTCAAACTCGAGTTTGACACGGTCGAAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080748
VALIDATED
ROMO1 MISSION shRNA Lentiviral Transduction Particles
reactive oxygen species modulator 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080748.2-219s21c1
Sequence:CCGGGATGGGTTGCGCCGTGGGCATCTCGAGATGCCCACGGCGCAACCCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080748.2-208s21c1
Sequence:CCGGATGGGCTTCGTGATGGGTTGCCTCGAGGCAACCCATCACGAAGCCCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080748.2-268s21c1
Sequence:CCGGTCCTGTCTCAGGATCGGAATGCTCGAGCATTCCGATCCTGAGACAGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080748.2-174s21c1
Sequence:CCGGACAGTCCCAGCCAAGCTGCTTCTCGAGAAGCAGCTTGGCTGGGACTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080748.2-187s21c1
Sequence:CCGGAGCTGCTTCGACCGTGTCAAACTCGAGTTTGACACGGTCGAAGCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)