EMAIL THIS PAGE TO A FRIEND

ROPN1B

rhophilin associated tail protein 1B

11 Gene Product Result for
Species: Human ROPN1B(152015)
UniProtKB ID: Q9BZX4, D3DNA6, Q96BM7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012337 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012337 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012337 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU105951 MISSION® esiRNA esiRNA human ROPN1B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012337 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153595 predicted 798
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012337
ROPN1B MISSION shRNA Bacterial Glycerol Stock
rhophilin associated tail protein 1B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000139110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012337.1-501s1c1
Sequence:CCGGCCAGATGTGGAAAGTGGTGAACTCGAGTTCACCACTTTCCACATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012337.1-768s1c1
Sequence:CCGGCAGCAGGATGCTAAACTACATCTCGAGATGTAGTTTAGCATCCTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012337.1-426s1c1
Sequence:CCGGGCTAACACCTGAGCTGTTAAACTCGAGTTTAACAGCTCAGGTGTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012337.1-502s1c1
Sequence:CCGGCAGATGTGGAAAGTGGTGAATCTCGAGATTCACCACTTTCCACATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012337.1-574s1c1
Sequence:CCGGGAGATCGAGTGGCTGAAGTTTCTCGAGAAACTTCAGCCACTCGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012337.1-793s1c1
Sequence:CCGGCAGGAAGTAATTGGTCCTGATCTCGAGATCAGGACCAATTACTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012337.1-519s1c1
Sequence:CCGGGAATCTCCCAACAGATCTGTTCTCGAGAACAGATCTGTTGGGAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012337.1-436s1c1
Sequence:CCGGGAGCTGTTAAAGATCCTGCATCTCGAGATGCAGGATCTTTAACAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012337
ROPN1B MISSION shRNA shRNA Plasmid DNA
rhophilin associated tail protein 1B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000139110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012337.1-501s1c1
Sequence:CCGGCCAGATGTGGAAAGTGGTGAACTCGAGTTCACCACTTTCCACATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012337.1-768s1c1
Sequence:CCGGCAGCAGGATGCTAAACTACATCTCGAGATGTAGTTTAGCATCCTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012337.1-426s1c1
Sequence:CCGGGCTAACACCTGAGCTGTTAAACTCGAGTTTAACAGCTCAGGTGTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012337.1-502s1c1
Sequence:CCGGCAGATGTGGAAAGTGGTGAATCTCGAGATTCACCACTTTCCACATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012337.1-574s1c1
Sequence:CCGGGAGATCGAGTGGCTGAAGTTTCTCGAGAAACTTCAGCCACTCGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012337.1-793s1c1
Sequence:CCGGCAGGAAGTAATTGGTCCTGATCTCGAGATCAGGACCAATTACTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012337.1-519s1c1
Sequence:CCGGGAATCTCCCAACAGATCTGTTCTCGAGAACAGATCTGTTGGGAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012337.1-436s1c1
Sequence:CCGGGAGCTGTTAAAGATCCTGCATCTCGAGATGCAGGATCTTTAACAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012337
ROPN1B MISSION shRNA Lentiviral Transduction Particles
rhophilin associated tail protein 1B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000139110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012337.1-501s1c1
Sequence:CCGGCCAGATGTGGAAAGTGGTGAACTCGAGTTCACCACTTTCCACATCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012337.1-768s1c1
Sequence:CCGGCAGCAGGATGCTAAACTACATCTCGAGATGTAGTTTAGCATCCTGCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012337.1-426s1c1
Sequence:CCGGGCTAACACCTGAGCTGTTAAACTCGAGTTTAACAGCTCAGGTGTTAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012337.1-502s1c1
Sequence:CCGGCAGATGTGGAAAGTGGTGAATCTCGAGATTCACCACTTTCCACATCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012337.1-574s1c1
Sequence:CCGGGAGATCGAGTGGCTGAAGTTTCTCGAGAAACTTCAGCCACTCGATCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012337.1-793s1c1
Sequence:CCGGCAGGAAGTAATTGGTCCTGATCTCGAGATCAGGACCAATTACTTCCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012337.1-519s1c1
Sequence:CCGGGAATCTCCCAACAGATCTGTTCTCGAGAACAGATCTGTTGGGAGATTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012337.1-436s1c1
Sequence:CCGGGAGCTGTTAAAGATCCTGCATCTCGAGATGCAGGATCTTTAACAGCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)