EMAIL THIS PAGE TO A FRIEND

ROPN1L

rhophilin associated tail protein 1-like

48 Gene Product Result for
Synonyms: ASP RSPH11
UniProtKB ID: Q96C74, D3DTC9, Q9BZX0
Gene ID:
Human(83853) Summary: This gene encodes a member of the ropporin family. The encoded protein is a sperm protein. It interacts with A-kinase anchoring protein, AKAP3, through the amphipathic helix region of AKAP3. Type II regulatory subunit of cAMP-dependent protein kinase (PKARII) also binds to this helix domain of AKAP3, which allows PKARII to be targeted to specific subcellular compartments. It is suggested that sperm contains several proteins that bind to AKAPs in a manner similar to PKARII, and this encoded protein may be one of them. Alternatively spliced transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Jan 2011]
Mouse(252967) ropporin 1-like
Rat(685646) rhophilin associated tail protein 1-like
Zebrafish(798354) ropporin 1-like
chicken(420926) rhophilin associated tail protein 1-like
dog(478616) rhophilin associated tail protein 1-like
domestic cat(101092664) rhophilin associated tail protein 1-like
domestic guinea pig(100717257) rhophilin associated tail protein 1-like
naked mole-rat(101725132) rhophilin associated tail protein 1-like
cow(515565) rhophilin associated tail protein 1-like
sheep(101121548) rhophilin associated tail protein 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031916 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031916 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031916 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145852 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145852 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145852 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031916 Rosetta Predictions human pricing
XM_001064653 Rosetta Predictions rat pricing
NM_145852 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224795 predicted 484
2 SASI_Hs01_00224796 predicted 528
3 SASI_Hs01_00224797 predicted 418
4 SASI_Hs01_00224798 predicted 788
5 SASI_Hs01_00224799 predicted 574
6 SASI_Hs01_00224800 predicted 701
7 SASI_Hs01_00224801 predicted 605
8 SASI_Hs02_00359046 predicted 433
9 SASI_Hs01_00224802 predicted 515
10 SASI_Hs01_00224803 predicted 672
11 SASI_Hs01_00224804 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064653 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00311347 predicted 935
2 SASI_Rn02_00311348 predicted 226
3 SASI_Rn02_00311349 predicted 587
4 SASI_Rn02_00311350 predicted 905
5 SASI_Rn02_00311351 predicted 670
6 SASI_Rn02_00311352 predicted 687
7 SASI_Rn02_00311353 predicted 241
8 SASI_Rn02_00311354 predicted 909
9 SASI_Rn02_00311355 predicted 665
10 SASI_Rn02_00311356 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145852 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341345 predicted 559
2 SASI_Mm01_00156203 predicted 571
3 SASI_Mm02_00341346 predicted 390
4 SASI_Mm01_00156205 predicted 389
5 SASI_Mm01_00156206 predicted 642
6 SASI_Mm01_00156207 predicted 411
7 SASI_Mm02_00341347 predicted 196
8 SASI_Mm02_00341348 predicted 404
9 SASI_Mm02_00341349 predicted 639
10 SASI_Mm02_00341350 predicted 648
11 SASI_Mm01_00156201 predicted 261
12 SASI_Mm01_00156202 predicted 453
13 SASI_Mm01_00156204 predicted 448
14 SASI_Mm01_00156208 predicted 542
15 SASI_Mm01_00156209 predicted 387
16 SASI_Mm01_00156210 predicted 545
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031916
ROPN1L MISSION shRNA Bacterial Glycerol Stock
rhophilin associated tail protein 1-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031916.3-877s21c1
Sequence:CCGGGAACGGCATGATAGGTCTTTCCTCGAGGAAAGACCTATCATGCCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031916.3-835s21c1
Sequence:CCGGATCCTACCTTGCCTCTCTAAACTCGAGTTTAGAGAGGCAAGGTAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031916.3-785s21c1
Sequence:CCGGTACCGCTACTTGGCCAGATTACTCGAGTAATCTGGCCAAGTAGCGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031916.2-876s1c1
Sequence:CCGGGCATGATAGGTCTTTCAGATTCTCGAGAATCTGAAAGACCTATCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031916.2-417s1c1
Sequence:CCGGGAGGAGATCCACTTCCTGTAACTCGAGTTACAGGAAGTGGATCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031916.2-431s1c1
Sequence:CCGGCCTGTAAAGGACAGAATGGAACTCGAGTTCCATTCTGTCCTTTACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031916.3-439s21c1
Sequence:CCGGTGTAAAGGACAGAATGGAAATCTCGAGATTTCCATTCTGTCCTTTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031916.3-535s21c1
Sequence:CCGGCAAGCGGTATGTGGAATTAACCTCGAGGTTAATTCCACATACCGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031916
ROPN1L MISSION shRNA shRNA Plasmid DNA
rhophilin associated tail protein 1-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031916.3-877s21c1
Sequence:CCGGGAACGGCATGATAGGTCTTTCCTCGAGGAAAGACCTATCATGCCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031916.3-835s21c1
Sequence:CCGGATCCTACCTTGCCTCTCTAAACTCGAGTTTAGAGAGGCAAGGTAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031916.3-785s21c1
Sequence:CCGGTACCGCTACTTGGCCAGATTACTCGAGTAATCTGGCCAAGTAGCGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031916.2-876s1c1
Sequence:CCGGGCATGATAGGTCTTTCAGATTCTCGAGAATCTGAAAGACCTATCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031916.2-417s1c1
Sequence:CCGGGAGGAGATCCACTTCCTGTAACTCGAGTTACAGGAAGTGGATCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031916.2-431s1c1
Sequence:CCGGCCTGTAAAGGACAGAATGGAACTCGAGTTCCATTCTGTCCTTTACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031916.3-439s21c1
Sequence:CCGGTGTAAAGGACAGAATGGAAATCTCGAGATTTCCATTCTGTCCTTTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031916.3-535s21c1
Sequence:CCGGCAAGCGGTATGTGGAATTAACCTCGAGGTTAATTCCACATACCGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031916
ROPN1L MISSION shRNA Lentiviral Transduction Particles
rhophilin associated tail protein 1-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031916.3-877s21c1
Sequence:CCGGGAACGGCATGATAGGTCTTTCCTCGAGGAAAGACCTATCATGCCGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031916.3-835s21c1
Sequence:CCGGATCCTACCTTGCCTCTCTAAACTCGAGTTTAGAGAGGCAAGGTAGGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031916.3-785s21c1
Sequence:CCGGTACCGCTACTTGGCCAGATTACTCGAGTAATCTGGCCAAGTAGCGGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031916.2-876s1c1
Sequence:CCGGGCATGATAGGTCTTTCAGATTCTCGAGAATCTGAAAGACCTATCATGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031916.2-417s1c1
Sequence:CCGGGAGGAGATCCACTTCCTGTAACTCGAGTTACAGGAAGTGGATCTCCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031916.2-431s1c1
Sequence:CCGGCCTGTAAAGGACAGAATGGAACTCGAGTTCCATTCTGTCCTTTACAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031916.3-439s21c1
Sequence:CCGGTGTAAAGGACAGAATGGAAATCTCGAGATTTCCATTCTGTCCTTTACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031916.3-535s21c1
Sequence:CCGGCAAGCGGTATGTGGAATTAACCTCGAGGTTAATTCCACATACCGCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145852
VALIDATED
ROPN1L MISSION shRNA Bacterial Glycerol Stock
rhophilin associated tail protein 1-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145852.1-663s1c1
Sequence:CCGGCCGAGAACTATCTTACCAGTTCTCGAGAACTGGTAAGATAGTTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145852.1-714s1c1
Sequence:CCGGGCATGATAGGACTTTCGGACTCTCGAGAGTCCGAAAGTCCTATCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145852.1-604s1c1
Sequence:CCGGCTTTGCCTATGTTTACCAGTACTCGAGTACTGGTAAACATAGGCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145852.1-371s1c1
Sequence:CCGGCAATATGTGGAGTTAGCAGATCTCGAGATCTGCTAACTCCACATATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145852.1-603s1c1
Sequence:CCGGCCTTTGCCTATGTTTACCAGTCTCGAGACTGGTAAACATAGGCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145852
VALIDATED
ROPN1L MISSION shRNA shRNA Plasmid DNA
rhophilin associated tail protein 1-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145852.1-663s1c1
Sequence:CCGGCCGAGAACTATCTTACCAGTTCTCGAGAACTGGTAAGATAGTTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145852.1-714s1c1
Sequence:CCGGGCATGATAGGACTTTCGGACTCTCGAGAGTCCGAAAGTCCTATCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145852.1-604s1c1
Sequence:CCGGCTTTGCCTATGTTTACCAGTACTCGAGTACTGGTAAACATAGGCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145852.1-371s1c1
Sequence:CCGGCAATATGTGGAGTTAGCAGATCTCGAGATCTGCTAACTCCACATATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145852.1-603s1c1
Sequence:CCGGCCTTTGCCTATGTTTACCAGTCTCGAGACTGGTAAACATAGGCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145852
VALIDATED
ROPN1L MISSION shRNA Lentiviral Transduction Particles
rhophilin associated tail protein 1-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145852.1-663s1c1
Sequence:CCGGCCGAGAACTATCTTACCAGTTCTCGAGAACTGGTAAGATAGTTCTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145852.1-714s1c1
Sequence:CCGGGCATGATAGGACTTTCGGACTCTCGAGAGTCCGAAAGTCCTATCATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145852.1-604s1c1
Sequence:CCGGCTTTGCCTATGTTTACCAGTACTCGAGTACTGGTAAACATAGGCAAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145852.1-371s1c1
Sequence:CCGGCAATATGTGGAGTTAGCAGATCTCGAGATCTGCTAACTCCACATATTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145852.1-603s1c1
Sequence:CCGGCCTTTGCCTATGTTTACCAGTCTCGAGACTGGTAAACATAGGCAAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)