EMAIL THIS PAGE TO A FRIEND

ROR1

receptor tyrosine kinase-like orphan receptor 1

68 Gene Product Result for
Synonyms: NTRKR1 dJ537F10.1
UniProtKB ID: Q01973, Q5VVX6, Q66K77, Q92776
Gene ID:
Human(4919) Summary: This gene encodes a receptor tyrosine kinase-like orphan receptor that modulates neurite growth in the central nervous system. The encoded protein is a glycosylated type I membrane protein that belongs to the ROR subfamily of cell surface receptors. It is a pseudokinase that lacks catalytic activity and may interact with the non-canonical Wnt signalling pathway. This gene is highly expressed during early embryonic development but expressed at very low levels in adult tissues. Increased expression of this gene is associated with B-cell chronic lymphocytic leukaemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2012]
Mouse(26563) receptor tyrosine kinase-like orphan receptor 1
Rat(362550) receptor tyrosine kinase-like orphan receptor 1
Zebrafish(568282) receptor tyrosine kinase-like orphan receptor 1
Horse(100069962) receptor tyrosine kinase-like orphan receptor 1
domestic cat(101100987) receptor tyrosine kinase-like orphan receptor 1
dog(489557) receptor tyrosine kinase-like orphan receptor 1
chicken(395179) receptor tyrosine kinase-like orphan receptor 1
naked mole-rat(101719678) receptor tyrosine kinase-like orphan receptor 1
domestic guinea pig(100728008) receptor tyrosine kinase-like orphan receptor 1
cow(783965) receptor tyrosine kinase-like orphan receptor 1
sheep(101109659) receptor tyrosine kinase-like orphan receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005012 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005012 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005012 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013845 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013845 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013845 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083592 Rosetta Predictions human pricing
NM_005012 Rosetta Predictions human pricing
NM_001108671 Rosetta Predictions rat pricing
NM_013845 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083592 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317011 predicted 1123
2 SASI_Hs02_00317012 predicted 650
3 SASI_Hs02_00317013 predicted 1133
4 SASI_Hs02_00317014 predicted 1078
5 SASI_Hs02_00317015 predicted 1162
6 SASI_Hs02_00317016 predicted 652
7 SASI_Hs02_00317017 predicted 862
8 SASI_Hs02_00317018 predicted 1327
9 SASI_Hs02_00317019 predicted 1271
10 SASI_Hs02_00317020 predicted 823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005012 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184445 predicted 1131
2 SASI_Hs02_00338772 predicted 658
3 SASI_Hs02_00338773 predicted 1126
4 SASI_Hs02_00338774 predicted 1081
5 SASI_Hs01_00184448 predicted 1160
6 SASI_Hs02_00338775 predicted 659
7 SASI_Hs02_00338776 predicted 868
8 SASI_Hs02_00338777 predicted 1328
9 SASI_Hs02_00338778 predicted 1274
10 SASI_Hs02_00338779 predicted 827
11 SASI_Hs01_00184442 predicted 2838
12 SASI_Hs01_00184443 predicted 1190
13 SASI_Hs01_00184444 predicted 1769
14 SASI_Hs01_00184446 predicted 2192
15 SASI_Hs01_00184447 predicted 2499
16 SASI_Hs01_00184449 predicted 1985
17 SASI_Hs01_00184450 predicted 1730
18 SASI_Hs01_00184451 predicted 2285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108671 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240925 predicted 1227
2 SASI_Rn02_00240926 predicted 2422
3 SASI_Rn02_00240927 predicted 1674
4 SASI_Rn02_00240928 predicted 2337
5 SASI_Rn02_00240929 predicted 795
6 SASI_Rn02_00240930 predicted 2287
7 SASI_Rn02_00240931 predicted 2412
8 SASI_Rn02_00240932 predicted 2066
9 SASI_Rn02_00240933 predicted 1220
10 SASI_Rn02_00240934 predicted 2001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013845 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081975 predicted 2891
2 SASI_Mm01_00081977 predicted 2424
3 SASI_Mm01_00081978 predicted 2459
4 SASI_Mm01_00081979 predicted 1253
5 SASI_Mm01_00081980 predicted 2823
6 SASI_Mm01_00081981 predicted 2071
7 SASI_Mm01_00081982 predicted 577
8 SASI_Mm01_00081983 predicted 1712
9 SASI_Mm02_00322850 predicted 1973
10 SASI_Mm01_00081984 predicted 1817
11 SASI_Mm01_00081976 predicted 1198
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005012
VALIDATED
ROR1 MISSION shRNA Bacterial Glycerol Stock
receptor tyrosine kinase-like orphan receptor 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005012.2-2268s21c1
Sequence:CCGGCGGAGAGCAACTTCATGTAAACTCGAGTTTACATGAAGTTGCTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_005012.x-3128s1c1
Sequence:CCGGCTTTACTAGGAGACGCCAATACTCGAGTATTGGCGTCTCCTAGTAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005012.x-929s1c1
Sequence:CCGGGCACCGTCTATATGGAGTCTTCTCGAGAAGACTCCATATAGACGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_005012.x-1626s1c1
Sequence:CCGGCATTGCTTTACTCTTCTTCTTCTCGAGAAGAAGAAGAGTAAAGCAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_005012.x-2244s1c1
Sequence:CCGGCGGAGAGCAACTTCATGTAAACTCGAGTTTACATGAAGTTGCTCTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005012.x-3280s1c1
Sequence:CCGGCTCATTTAGCAGACATCGCAACTCGAGTTGCGATGTCTGCTAAATGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005012.2-3152s21c1
Sequence:CCGGCTTTACTAGGAGACGCCAATACTCGAGTATTGGCGTCTCCTAGTAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005012.2-3304s21c1
Sequence:CCGGCTCATTTAGCAGACATCGCAACTCGAGTTGCGATGTCTGCTAAATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005012.2-953s21c1
Sequence:CCGGGCACCGTCTATATGGAGTCTTCTCGAGAAGACTCCATATAGACGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005012.1-1068s1c1
Sequence:CCGGCTTCCCGTACTGCGATGAAACCTCGAGGTTTCATCGCAGTACGGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005012.1-1175s1c1
Sequence:CCGGCAAGATCAAATCCCATGATTCCTCGAGGAATCATGGGATTTGATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005012
VALIDATED
ROR1 MISSION shRNA shRNA Plasmid DNA
receptor tyrosine kinase-like orphan receptor 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005012.2-2268s21c1
Sequence:CCGGCGGAGAGCAACTTCATGTAAACTCGAGTTTACATGAAGTTGCTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_005012.x-3128s1c1
Sequence:CCGGCTTTACTAGGAGACGCCAATACTCGAGTATTGGCGTCTCCTAGTAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005012.x-929s1c1
Sequence:CCGGGCACCGTCTATATGGAGTCTTCTCGAGAAGACTCCATATAGACGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_005012.x-1626s1c1
Sequence:CCGGCATTGCTTTACTCTTCTTCTTCTCGAGAAGAAGAAGAGTAAAGCAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_005012.x-2244s1c1
Sequence:CCGGCGGAGAGCAACTTCATGTAAACTCGAGTTTACATGAAGTTGCTCTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005012.x-3280s1c1
Sequence:CCGGCTCATTTAGCAGACATCGCAACTCGAGTTGCGATGTCTGCTAAATGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005012.2-3152s21c1
Sequence:CCGGCTTTACTAGGAGACGCCAATACTCGAGTATTGGCGTCTCCTAGTAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005012.2-3304s21c1
Sequence:CCGGCTCATTTAGCAGACATCGCAACTCGAGTTGCGATGTCTGCTAAATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005012.2-953s21c1
Sequence:CCGGGCACCGTCTATATGGAGTCTTCTCGAGAAGACTCCATATAGACGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005012.1-1068s1c1
Sequence:CCGGCTTCCCGTACTGCGATGAAACCTCGAGGTTTCATCGCAGTACGGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005012.1-1175s1c1
Sequence:CCGGCAAGATCAAATCCCATGATTCCTCGAGGAATCATGGGATTTGATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005012
VALIDATED
ROR1 MISSION shRNA Lentiviral Transduction Particles
receptor tyrosine kinase-like orphan receptor 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005012.2-2268s21c1
Sequence:CCGGCGGAGAGCAACTTCATGTAAACTCGAGTTTACATGAAGTTGCTCTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_005012.x-3128s1c1
Sequence:CCGGCTTTACTAGGAGACGCCAATACTCGAGTATTGGCGTCTCCTAGTAAAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005012.x-929s1c1
Sequence:CCGGGCACCGTCTATATGGAGTCTTCTCGAGAAGACTCCATATAGACGGTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_005012.x-1626s1c1
Sequence:CCGGCATTGCTTTACTCTTCTTCTTCTCGAGAAGAAGAAGAGTAAAGCAATGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_005012.x-2244s1c1
Sequence:CCGGCGGAGAGCAACTTCATGTAAACTCGAGTTTACATGAAGTTGCTCTCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005012.x-3280s1c1
Sequence:CCGGCTCATTTAGCAGACATCGCAACTCGAGTTGCGATGTCTGCTAAATGAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005012.2-3152s21c1
Sequence:CCGGCTTTACTAGGAGACGCCAATACTCGAGTATTGGCGTCTCCTAGTAAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005012.2-3304s21c1
Sequence:CCGGCTCATTTAGCAGACATCGCAACTCGAGTTGCGATGTCTGCTAAATGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005012.2-953s21c1
Sequence:CCGGGCACCGTCTATATGGAGTCTTCTCGAGAAGACTCCATATAGACGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005012.1-1068s1c1
Sequence:CCGGCTTCCCGTACTGCGATGAAACCTCGAGGTTTCATCGCAGTACGGGAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005012.1-1175s1c1
Sequence:CCGGCAAGATCAAATCCCATGATTCCTCGAGGAATCATGGGATTTGATCTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013845
ROR1 MISSION shRNA Bacterial Glycerol Stock
receptor tyrosine kinase-like orphan receptor 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013845.2-2502s1c1
Sequence:CCGGGCCATATTATGGGTTTAGTAACTCGAGTTACTAAACCCATAATATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013845.2-2881s1c1
Sequence:CCGGCCCATCAATGGATACCCAATACTCGAGTATTGGGTATCCATTGATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013845.2-563s1c1
Sequence:CCGGCCTGGAACACTTCAAGTGAAACTCGAGTTTCACTTGAAGTGTTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013845.2-1712s1c1
Sequence:CCGGGCCGCAATAACCAGAAGTCTTCTCGAGAAGACTTCTGGTTATTGCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013845.4-953s21c1
Sequence:CCGGCATTGCATGTGCACGATTTATCTCGAGATAAATCGTGCACATGCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013845.4-1331s21c1
Sequence:CCGGTCCCATGGCGGATCCTATAAACTCGAGTTTATAGGATCCGCCATGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013845.4-1700s21c1
Sequence:CCGGCATCTGTGTGTGCCGCAATAACTCGAGTTATTGCGGCACACACAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013845
ROR1 MISSION shRNA shRNA Plasmid DNA
receptor tyrosine kinase-like orphan receptor 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013845.2-2502s1c1
Sequence:CCGGGCCATATTATGGGTTTAGTAACTCGAGTTACTAAACCCATAATATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013845.2-2881s1c1
Sequence:CCGGCCCATCAATGGATACCCAATACTCGAGTATTGGGTATCCATTGATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013845.2-563s1c1
Sequence:CCGGCCTGGAACACTTCAAGTGAAACTCGAGTTTCACTTGAAGTGTTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013845.2-1712s1c1
Sequence:CCGGGCCGCAATAACCAGAAGTCTTCTCGAGAAGACTTCTGGTTATTGCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013845.4-953s21c1
Sequence:CCGGCATTGCATGTGCACGATTTATCTCGAGATAAATCGTGCACATGCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013845.4-1331s21c1
Sequence:CCGGTCCCATGGCGGATCCTATAAACTCGAGTTTATAGGATCCGCCATGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013845.4-1700s21c1
Sequence:CCGGCATCTGTGTGTGCCGCAATAACTCGAGTTATTGCGGCACACACAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013845
ROR1 MISSION shRNA Lentiviral Transduction Particles
receptor tyrosine kinase-like orphan receptor 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013845.2-2502s1c1
Sequence:CCGGGCCATATTATGGGTTTAGTAACTCGAGTTACTAAACCCATAATATGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013845.2-2881s1c1
Sequence:CCGGCCCATCAATGGATACCCAATACTCGAGTATTGGGTATCCATTGATGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013845.2-563s1c1
Sequence:CCGGCCTGGAACACTTCAAGTGAAACTCGAGTTTCACTTGAAGTGTTCCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013845.2-1712s1c1
Sequence:CCGGGCCGCAATAACCAGAAGTCTTCTCGAGAAGACTTCTGGTTATTGCGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013845.4-953s21c1
Sequence:CCGGCATTGCATGTGCACGATTTATCTCGAGATAAATCGTGCACATGCAATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013845.4-1331s21c1
Sequence:CCGGTCCCATGGCGGATCCTATAAACTCGAGTTTATAGGATCCGCCATGGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013845.4-1700s21c1
Sequence:CCGGCATCTGTGTGTGCCGCAATAACTCGAGTTATTGCGGCACACACAGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)