EMAIL THIS PAGE TO A FRIEND

RORA

RAR-related orphan receptor A

135 Gene Product Result for
Synonyms: NR1F1 ROR1 ROR2 ROR3 RZR-ALPHA RZRA
UniProtKB ID: P35398, P35397, P35399, P45445, Q495X4, Q96H83
Gene ID:
Human(6095) Summary: The protein encoded by this gene is a member of the NR1 subfamily of nuclear hormone receptors. It can bind as a monomer or as a homodimer to hormone response elements upstream of several genes to enhance the expression of those genes. The specific functions of this protein are not known, but it has been shown to interact with NM23-2, a nucleoside diphosphate kinase involved in organogenesis and differentiation, as well as with NM23-1, the product of a tumor metastasis suppressor candidate gene. Four transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(19883) RAR-related orphan receptor alpha
Rat(300807) RAR-related orphan receptor A
chicken(415377) RAR-related orphan receptor A
dog(478328) RAR-related orphan receptor A
domestic cat(101099721) RAR-related orphan receptor A
naked mole-rat(101721524) RAR-related orphan receptor A
domestic guinea pig(100725707) RAR-related orphan receptor A
cow(535597) RAR-related orphan receptor A
sheep(101102986) RAR-related orphan receptor A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013646 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013646 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013646 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002943 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002943 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002943 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU072741 MISSION® esiRNA esiRNA human RORA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002943 Rosetta Predictions human pricing
NM_134260 Rosetta Predictions human pricing
NM_134261 Rosetta Predictions human pricing
NM_134262 Rosetta Predictions human pricing
NM_001106834 Rosetta Predictions rat pricing
NM_013646 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122179 predicted 1304
2 SASI_Hs01_00122180 predicted 1145
3 SASI_Hs01_00122181 predicted 1584
4 SASI_Hs01_00122182 predicted 1066
5 SASI_Hs01_00122183 predicted 949
6 SASI_Hs01_00122184 predicted 1347
7 SASI_Hs01_00122185 predicted 786
8 SASI_Hs01_00122186 predicted 1365
9 SASI_Hs01_00122187 predicted 1615
10 SASI_Hs01_00122188 predicted 889
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134260 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048340 predicted 1333
2 SASI_Hs01_00048341 predicted 1173
3 SASI_Hs01_00048342 predicted 1603
4 SASI_Hs01_00048343 predicted 1086
5 SASI_Hs01_00048344 predicted 978
6 SASI_Hs01_00048345 predicted 1369
7 SASI_Hs01_00048346 predicted 807
8 SASI_Hs01_00048347 predicted 1390
9 SASI_Hs01_00048348 predicted 1641
10 SASI_Hs01_00048349 predicted 916
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134261 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184302 predicted 1162
2 SASI_Hs01_00184303 predicted 999
3 SASI_Hs01_00184304 predicted 1430
4 SASI_Hs01_00184305 predicted 914
5 SASI_Hs01_00184306 predicted 806
6 SASI_Hs01_00184307 predicted 1201
7 SASI_Hs01_00184308 predicted 631
8 SASI_Hs01_00184309 predicted 1219
9 SASI_Hs01_00184310 predicted 1469
10 SASI_Hs01_00184311 predicted 737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134262 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194423 predicted 996
2 SASI_Hs01_00194424 predicted 843
3 SASI_Hs01_00194425 predicted 1275
4 SASI_Hs01_00194426 predicted 754
5 SASI_Hs01_00194427 predicted 644
6 SASI_Hs01_00194428 predicted 1039
7 SASI_Hs01_00194429 predicted 477
8 SASI_Hs01_00194430 predicted 1061
9 SASI_Hs01_00194431 predicted 1306
10 SASI_Hs01_00194432 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106834 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222868 predicted 552
2 SASI_Rn02_00222869 predicted 836
3 SASI_Rn02_00222870 predicted 904
4 SASI_Rn02_00222871 predicted 1124
5 SASI_Rn02_00222872 predicted 1012
6 SASI_Rn02_00222873 predicted 1004
7 SASI_Rn02_00222874 predicted 1045
8 SASI_Rn02_00222875 predicted 714
9 SASI_Rn02_00222876 predicted 958
10 SASI_Rn02_00222877 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013646 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034667 predicted 1393
2 SASI_Mm01_00034669 predicted 893
3 SASI_Mm01_00034670 predicted 232
4 SASI_Mm01_00034671 predicted 373
5 SASI_Mm01_00034672 predicted 1119
6 SASI_Mm01_00034673 predicted 713
7 SASI_Mm01_00034674 predicted 713
8 SASI_Mm01_00034675 predicted 852
9 SASI_Mm01_00034676 predicted 1125
10 SASI_Mm02_00322450 predicted 693
11 SASI_Mm01_00034668 predicted 1219
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013646
RORA MISSION shRNA Bacterial Glycerol Stock
RAR-related orphan receptor A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-1426s1c1
Sequence:CCGGTGTCTACGTTAAGAGCCCTATCTCGAGATAGGGCTCTTAACGTAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-1252s1c1
Sequence:CCGGCCGAAGACGAAATCGCGTTATCTCGAGATAACGCGATTTCGTCTTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-696s1c1
Sequence:CCGGCAGTCGGGATTGGACATCAATCTCGAGATTGATGTCCAATCCCGACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-1374s1c1
Sequence:CCGGCTACAGAAGAACCACCGAGAACTCGAGTTCTCGGTGGTTCTTCTGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-193s1c1
Sequence:CCGGCACACACATCTCAAATTGAAACTCGAGTTTCAATTTGAGATGTGTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-976s1c1
Sequence:CCGGCCATCAAGATTACAGAAGCTACTCGAGTAGCTTCTGTAATCTTGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-232s1c1
Sequence:CCGGGTGGAGACAAATCGTCAGGAACTCGAGTTCCTGACGATTTGTCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-831s1c1
Sequence:CCGGCTTGCCCAGAACATATCCAAACTCGAGTTTGGATATGTTCTGGGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-167s1c1
Sequence:CCGGCCGAGGTATCTCAGTCACGAACTCGAGTTCGTGACTGAGATACCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-1492s1c1
Sequence:CCGGCAGACATTGTGCGACTCCATTCTCGAGAATGGAGTCGCACAATGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013646
RORA MISSION shRNA shRNA Plasmid DNA
RAR-related orphan receptor A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-1426s1c1
Sequence:CCGGTGTCTACGTTAAGAGCCCTATCTCGAGATAGGGCTCTTAACGTAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-1252s1c1
Sequence:CCGGCCGAAGACGAAATCGCGTTATCTCGAGATAACGCGATTTCGTCTTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-696s1c1
Sequence:CCGGCAGTCGGGATTGGACATCAATCTCGAGATTGATGTCCAATCCCGACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-1374s1c1
Sequence:CCGGCTACAGAAGAACCACCGAGAACTCGAGTTCTCGGTGGTTCTTCTGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-193s1c1
Sequence:CCGGCACACACATCTCAAATTGAAACTCGAGTTTCAATTTGAGATGTGTGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-976s1c1
Sequence:CCGGCCATCAAGATTACAGAAGCTACTCGAGTAGCTTCTGTAATCTTGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-232s1c1
Sequence:CCGGGTGGAGACAAATCGTCAGGAACTCGAGTTCCTGACGATTTGTCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-831s1c1
Sequence:CCGGCTTGCCCAGAACATATCCAAACTCGAGTTTGGATATGTTCTGGGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-167s1c1
Sequence:CCGGCCGAGGTATCTCAGTCACGAACTCGAGTTCGTGACTGAGATACCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-1492s1c1
Sequence:CCGGCAGACATTGTGCGACTCCATTCTCGAGAATGGAGTCGCACAATGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013646
RORA MISSION shRNA Lentiviral Transduction Particles
RAR-related orphan receptor A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-1426s1c1
Sequence:CCGGTGTCTACGTTAAGAGCCCTATCTCGAGATAGGGCTCTTAACGTAGACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-1252s1c1
Sequence:CCGGCCGAAGACGAAATCGCGTTATCTCGAGATAACGCGATTTCGTCTTCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-696s1c1
Sequence:CCGGCAGTCGGGATTGGACATCAATCTCGAGATTGATGTCCAATCCCGACTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-1374s1c1
Sequence:CCGGCTACAGAAGAACCACCGAGAACTCGAGTTCTCGGTGGTTCTTCTGTAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-193s1c1
Sequence:CCGGCACACACATCTCAAATTGAAACTCGAGTTTCAATTTGAGATGTGTGTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-976s1c1
Sequence:CCGGCCATCAAGATTACAGAAGCTACTCGAGTAGCTTCTGTAATCTTGATGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-232s1c1
Sequence:CCGGGTGGAGACAAATCGTCAGGAACTCGAGTTCCTGACGATTTGTCTCCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-831s1c1
Sequence:CCGGCTTGCCCAGAACATATCCAAACTCGAGTTTGGATATGTTCTGGGCAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-167s1c1
Sequence:CCGGCCGAGGTATCTCAGTCACGAACTCGAGTTCGTGACTGAGATACCTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013646.1-1492s1c1
Sequence:CCGGCAGACATTGTGCGACTCCATTCTCGAGAATGGAGTCGCACAATGTCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002943
RORA MISSION shRNA Bacterial Glycerol Stock
RAR-related orphan receptor A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002943.3-2199s21c1
Sequence:CCGGATAGCGGAGGTTGCGGCATTACTCGAGTAATGCCGCAACCTCCGCTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002943.3-2071s21c1
Sequence:CCGGCAACAGGAGGAGGGTACTAAACTCGAGTTTAGTACCCTCCTCCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002943.2-1412s1c1
Sequence:CCGGCCTTAGGTTGTGAAGACTTTACTCGAGTAAAGTCTTCACAACCTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002943.2-479s1c1
Sequence:CCGGGAATCCATTATGGTGTCATTACTCGAGTAATGACACCATAATGGATTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002943.2-1083s1c1
Sequence:CCGGGCATCTGGAAACCTGCCAATACTCGAGTATTGGCAGGTTTCCAGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002943.2-1247s1c1
Sequence:CCGGCCAAACGCATTGATGGATTTACTCGAGTAAATCCATCAATGCGTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002943.2-1720s1c1
Sequence:CCGGCCAGACATTGTGCGACTTCATCTCGAGATGAAGTCGCACAATGTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002943.3-1786s21c1
Sequence:CCGGATGCAAATTGATGGGTAAATGCTCGAGCATTTACCCATCAATTTGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002943
RORA MISSION shRNA shRNA Plasmid DNA
RAR-related orphan receptor A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002943.3-2199s21c1
Sequence:CCGGATAGCGGAGGTTGCGGCATTACTCGAGTAATGCCGCAACCTCCGCTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002943.3-2071s21c1
Sequence:CCGGCAACAGGAGGAGGGTACTAAACTCGAGTTTAGTACCCTCCTCCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002943.2-1412s1c1
Sequence:CCGGCCTTAGGTTGTGAAGACTTTACTCGAGTAAAGTCTTCACAACCTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002943.2-479s1c1
Sequence:CCGGGAATCCATTATGGTGTCATTACTCGAGTAATGACACCATAATGGATTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002943.2-1083s1c1
Sequence:CCGGGCATCTGGAAACCTGCCAATACTCGAGTATTGGCAGGTTTCCAGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002943.2-1247s1c1
Sequence:CCGGCCAAACGCATTGATGGATTTACTCGAGTAAATCCATCAATGCGTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002943.2-1720s1c1
Sequence:CCGGCCAGACATTGTGCGACTTCATCTCGAGATGAAGTCGCACAATGTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002943.3-1786s21c1
Sequence:CCGGATGCAAATTGATGGGTAAATGCTCGAGCATTTACCCATCAATTTGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002943
RORA MISSION shRNA Lentiviral Transduction Particles
RAR-related orphan receptor A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002943.3-2199s21c1
Sequence:CCGGATAGCGGAGGTTGCGGCATTACTCGAGTAATGCCGCAACCTCCGCTATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002943.3-2071s21c1
Sequence:CCGGCAACAGGAGGAGGGTACTAAACTCGAGTTTAGTACCCTCCTCCTGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002943.2-1412s1c1
Sequence:CCGGCCTTAGGTTGTGAAGACTTTACTCGAGTAAAGTCTTCACAACCTAAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002943.2-479s1c1
Sequence:CCGGGAATCCATTATGGTGTCATTACTCGAGTAATGACACCATAATGGATTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002943.2-1083s1c1
Sequence:CCGGGCATCTGGAAACCTGCCAATACTCGAGTATTGGCAGGTTTCCAGATGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002943.2-1247s1c1
Sequence:CCGGCCAAACGCATTGATGGATTTACTCGAGTAAATCCATCAATGCGTTTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002943.2-1720s1c1
Sequence:CCGGCCAGACATTGTGCGACTTCATCTCGAGATGAAGTCGCACAATGTCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002943.3-1786s21c1
Sequence:CCGGATGCAAATTGATGGGTAAATGCTCGAGCATTTACCCATCAATTTGCATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)