EMAIL THIS PAGE TO A FRIEND

ROS1

c-ros oncogene 1 , receptor tyrosine kinase

62 Gene Product Result for
Synonyms: MCF3 ROS c-ros-1
UniProtKB ID: P08922, Q15368, Q5TDB5
Gene ID:
Human(6098) Summary: This proto-oncogene, highly-expressed in a variety of tumor cell lines, belongs to the sevenless subfamily of tyrosine kinase insulin receptor genes. The protein encoded by this gene is a type I integral membrane protein with tyrosine kinase activity. The protein may function as a growth or differentiation factor receptor. [provided by RefSeq, Jul 2008]
Mouse(19886) Ros1 proto-oncogene
Rat(25346) c-ros oncogene 1 , receptor tyrosine kinase
Zebrafish(245951) v-ros UR2 sarcoma virus oncogene homolog 1 (avian)
chicken(396192) c-ros oncogene 1 , receptor tyrosine kinase
domestic cat(101093437) c-ros oncogene 1 , receptor tyrosine kinase
dog(484098) c-ros oncogene 1 , receptor tyrosine kinase
cow(100336768) c-ros oncogene 1 , receptor tyrosine kinase
sheep(101103481) c-ros oncogene 1 , receptor tyrosine kinase
domestic guinea pig(100725080) c-ros oncogene 1 , receptor tyrosine kinase
naked mole-rat(101715520) c-ros oncogene 1 , receptor tyrosine kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0990 Phosphotyrosine ROS1 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011282 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011282 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011282 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002944 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002944 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002944 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002944 Rosetta Predictions human pricing
NM_012874 Rosetta Predictions rat pricing
NM_011282 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002944 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183685 predicted 6987
2 SASI_Hs01_00183686 predicted 2341
3 SASI_Hs01_00183688 predicted 5380
4 SASI_Hs01_00183689 predicted 1135
5 SASI_Hs01_00183690 predicted 6968
6 SASI_Hs02_00334785 predicted 1790
7 SASI_Hs02_00334786 predicted 615
8 SASI_Hs02_00334787 predicted 4955
9 SASI_Hs01_00183692 predicted 3605
10 SASI_Hs01_00183694 predicted 6463
11 SASI_Hs01_00183687 predicted 2125
12 SASI_Hs01_00183691 predicted 3770
13 SASI_Hs01_00183693 predicted 2895
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012874 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099893 predicted 1748
2 SASI_Rn02_00260378 predicted 862
3 SASI_Rn01_00099896 predicted 2473
4 SASI_Rn02_00260379 predicted 6135
5 SASI_Rn02_00260380 predicted 2206
6 SASI_Rn01_00099897 predicted 3693
7 SASI_Rn01_00099898 predicted 494
8 SASI_Rn01_00099899 predicted 6646
9 SASI_Rn01_00099901 predicted 1760
10 SASI_Rn01_00099902 predicted 7220
11 SASI_Rn01_00099894 predicted 5143
12 SASI_Rn01_00099895 predicted 2508
13 SASI_Rn01_00099900 predicted 3157
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011282 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041836 predicted 6505
2 SASI_Mm01_00041837 predicted 3714
3 SASI_Mm02_00320325 predicted 3018
4 SASI_Mm02_00320326 predicted 1263
5 SASI_Mm01_00041838 predicted 2097
6 SASI_Mm01_00041839 predicted 4623
7 SASI_Mm02_00320327 predicted 4550
8 SASI_Mm01_00041842 predicted 2475
9 SASI_Mm01_00041843 predicted 389
10 SASI_Mm01_00041845 predicted 1657
11 SASI_Mm01_00041840 predicted 2176
12 SASI_Mm01_00041841 predicted 3551
13 SASI_Mm01_00041844 predicted 3513
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011282
ROS1 MISSION shRNA Bacterial Glycerol Stock
c-ros oncogene 1 , receptor tyrosine kinase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011282.1-3032s1c1
Sequence:CCGGGCCAGCGAAATTCAATCAGTTCTCGAGAACTGATTGAATTTCGCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011282.1-6825s1c1
Sequence:CCGGCCTGATGATCTGTGGAATTTACTCGAGTAAATTCCACAGATCATCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011282.1-4131s1c1
Sequence:CCGGCGCTTGTATTGGACAGAAGTTCTCGAGAACTTCTGTCCAATACAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011282.1-1365s1c1
Sequence:CCGGGCTGCCAACATGTCTGATGTACTCGAGTACATCAGACATGTTGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011282.1-5085s1c1
Sequence:CCGGCCTCTAAGACAGGGTGAATTTCTCGAGAAATTCACCCTGTCTTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011282.1-6882s1c1
Sequence:CCGGCCCACTTTCCATAACATTCAACTCGAGTTGAATGTTATGGAAAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011282.1-6259s1c1
Sequence:CCGGCGCACCTGATGAGCAAGTTTACTCGAGTAAACTTGCTCATCAGGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011282.1-2393s1c1
Sequence:CCGGCGTGTCAGATATGGATTGGTACTCGAGTACCAATCCATATCTGACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011282.1-682s1c1
Sequence:CCGGCCAACATCTCTGGAGTCAAATCTCGAGATTTGACTCCAGAGATGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011282
ROS1 MISSION shRNA shRNA Plasmid DNA
c-ros oncogene 1 , receptor tyrosine kinase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011282.1-3032s1c1
Sequence:CCGGGCCAGCGAAATTCAATCAGTTCTCGAGAACTGATTGAATTTCGCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011282.1-6825s1c1
Sequence:CCGGCCTGATGATCTGTGGAATTTACTCGAGTAAATTCCACAGATCATCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011282.1-4131s1c1
Sequence:CCGGCGCTTGTATTGGACAGAAGTTCTCGAGAACTTCTGTCCAATACAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011282.1-1365s1c1
Sequence:CCGGGCTGCCAACATGTCTGATGTACTCGAGTACATCAGACATGTTGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011282.1-5085s1c1
Sequence:CCGGCCTCTAAGACAGGGTGAATTTCTCGAGAAATTCACCCTGTCTTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011282.1-6882s1c1
Sequence:CCGGCCCACTTTCCATAACATTCAACTCGAGTTGAATGTTATGGAAAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011282.1-6259s1c1
Sequence:CCGGCGCACCTGATGAGCAAGTTTACTCGAGTAAACTTGCTCATCAGGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011282.1-2393s1c1
Sequence:CCGGCGTGTCAGATATGGATTGGTACTCGAGTACCAATCCATATCTGACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011282.1-682s1c1
Sequence:CCGGCCAACATCTCTGGAGTCAAATCTCGAGATTTGACTCCAGAGATGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011282
ROS1 MISSION shRNA Lentiviral Transduction Particles
c-ros oncogene 1 , receptor tyrosine kinase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011282.1-3032s1c1
Sequence:CCGGGCCAGCGAAATTCAATCAGTTCTCGAGAACTGATTGAATTTCGCTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011282.1-6825s1c1
Sequence:CCGGCCTGATGATCTGTGGAATTTACTCGAGTAAATTCCACAGATCATCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011282.1-4131s1c1
Sequence:CCGGCGCTTGTATTGGACAGAAGTTCTCGAGAACTTCTGTCCAATACAAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011282.1-1365s1c1
Sequence:CCGGGCTGCCAACATGTCTGATGTACTCGAGTACATCAGACATGTTGGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011282.1-5085s1c1
Sequence:CCGGCCTCTAAGACAGGGTGAATTTCTCGAGAAATTCACCCTGTCTTAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011282.1-6882s1c1
Sequence:CCGGCCCACTTTCCATAACATTCAACTCGAGTTGAATGTTATGGAAAGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011282.1-6259s1c1
Sequence:CCGGCGCACCTGATGAGCAAGTTTACTCGAGTAAACTTGCTCATCAGGTGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011282.1-2393s1c1
Sequence:CCGGCGTGTCAGATATGGATTGGTACTCGAGTACCAATCCATATCTGACACGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011282.1-682s1c1
Sequence:CCGGCCAACATCTCTGGAGTCAAATCTCGAGATTTGACTCCAGAGATGTTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002944
VALIDATED
ROS1 MISSION shRNA Bacterial Glycerol Stock
c-ros oncogene 1 , receptor tyrosine kinase
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002944.x-7254s1c1
Sequence:CCGGTGGGAAATAGAGAGTTGAGATCTCGAGATCTCAACTCTCTATTTCCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002944.x-4143s1c1
Sequence:CCGGCCACAGCTACAAACCAACAAACTCGAGTTTGTTGGTTTGTAGCTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002944.x-3659s1c1
Sequence:CCGGCCTCACCTCATAACTCTTCTTCTCGAGAAGAAGAGTTATGAGGTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002944.x-6235s1c1
Sequence:CCGGGCTTGGAGTTTGTCTGCTGAACTCGAGTTCAGCAGACAAACTCCAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002944.x-294s1c1
Sequence:CCGGGCTGCCTAAAGTCGTGTGTAACTCGAGTTACACACGACTTTAGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002944.2-4365s21c1
Sequence:CCGGCTGTGGATGGAGATCTTATATCTCGAGATATAAGATCTCCATCCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002944.2-1144s21c1
Sequence:CCGGCCTTCGGTTGGATGCTATATACTCGAGTATATAGCATCCAACCGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002944.2-6512s21c1
Sequence:CCGGCTCGCCAGAGACATCTATAAACTCGAGTTTATAGATGTCTCTGGCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002944.2-1584s21c1
Sequence:CCGGCACAAGCCAAGCGAATCATTTCTCGAGAAATGATTCGCTTGGCTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002944.2-3772s21c1
Sequence:CCGGTGATAATGAGATGGGATATTACTCGAGTAATATCCCATCTCATTATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002944.2-3772s1c1
Sequence:CCGGTGATAATGAGATGGGATATTACTCGAGTAATATCCCATCTCATTATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002944.2-788s1c1
Sequence:CCGGGCACCTTTGATTAGGAATATTCTCGAGAATATTCCTAATCAAAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002944.2-1622s1c1
Sequence:CCGGCAAGTCTTCATGTCAACATTTCTCGAGAAATGTTGACATGAAGACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002944.2-1144s1c1
Sequence:CCGGCCTTCGGTTGGATGCTATATACTCGAGTATATAGCATCCAACCGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002944.2-4365s1c1
Sequence:CCGGCTGTGGATGGAGATCTTATATCTCGAGATATAAGATCTCCATCCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002944
VALIDATED
ROS1 MISSION shRNA shRNA Plasmid DNA
c-ros oncogene 1 , receptor tyrosine kinase
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002944.x-7254s1c1
Sequence:CCGGTGGGAAATAGAGAGTTGAGATCTCGAGATCTCAACTCTCTATTTCCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002944.x-4143s1c1
Sequence:CCGGCCACAGCTACAAACCAACAAACTCGAGTTTGTTGGTTTGTAGCTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002944.x-3659s1c1
Sequence:CCGGCCTCACCTCATAACTCTTCTTCTCGAGAAGAAGAGTTATGAGGTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002944.x-6235s1c1
Sequence:CCGGGCTTGGAGTTTGTCTGCTGAACTCGAGTTCAGCAGACAAACTCCAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002944.x-294s1c1
Sequence:CCGGGCTGCCTAAAGTCGTGTGTAACTCGAGTTACACACGACTTTAGGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002944.2-4365s21c1
Sequence:CCGGCTGTGGATGGAGATCTTATATCTCGAGATATAAGATCTCCATCCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002944.2-1144s21c1
Sequence:CCGGCCTTCGGTTGGATGCTATATACTCGAGTATATAGCATCCAACCGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002944.2-6512s21c1
Sequence:CCGGCTCGCCAGAGACATCTATAAACTCGAGTTTATAGATGTCTCTGGCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002944.2-1584s21c1
Sequence:CCGGCACAAGCCAAGCGAATCATTTCTCGAGAAATGATTCGCTTGGCTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002944.2-3772s21c1
Sequence:CCGGTGATAATGAGATGGGATATTACTCGAGTAATATCCCATCTCATTATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002944.2-3772s1c1
Sequence:CCGGTGATAATGAGATGGGATATTACTCGAGTAATATCCCATCTCATTATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002944.2-788s1c1
Sequence:CCGGGCACCTTTGATTAGGAATATTCTCGAGAATATTCCTAATCAAAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002944.2-1622s1c1
Sequence:CCGGCAAGTCTTCATGTCAACATTTCTCGAGAAATGTTGACATGAAGACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002944.2-1144s1c1
Sequence:CCGGCCTTCGGTTGGATGCTATATACTCGAGTATATAGCATCCAACCGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002944.2-4365s1c1
Sequence:CCGGCTGTGGATGGAGATCTTATATCTCGAGATATAAGATCTCCATCCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002944
VALIDATED
ROS1 MISSION shRNA Lentiviral Transduction Particles
c-ros oncogene 1 , receptor tyrosine kinase
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002944.x-7254s1c1
Sequence:CCGGTGGGAAATAGAGAGTTGAGATCTCGAGATCTCAACTCTCTATTTCCCATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002944.x-4143s1c1
Sequence:CCGGCCACAGCTACAAACCAACAAACTCGAGTTTGTTGGTTTGTAGCTGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002944.x-3659s1c1
Sequence:CCGGCCTCACCTCATAACTCTTCTTCTCGAGAAGAAGAGTTATGAGGTGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002944.x-6235s1c1
Sequence:CCGGGCTTGGAGTTTGTCTGCTGAACTCGAGTTCAGCAGACAAACTCCAAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002944.x-294s1c1
Sequence:CCGGGCTGCCTAAAGTCGTGTGTAACTCGAGTTACACACGACTTTAGGCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002944.2-4365s21c1
Sequence:CCGGCTGTGGATGGAGATCTTATATCTCGAGATATAAGATCTCCATCCACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002944.2-1144s21c1
Sequence:CCGGCCTTCGGTTGGATGCTATATACTCGAGTATATAGCATCCAACCGAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002944.2-6512s21c1
Sequence:CCGGCTCGCCAGAGACATCTATAAACTCGAGTTTATAGATGTCTCTGGCGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002944.2-1584s21c1
Sequence:CCGGCACAAGCCAAGCGAATCATTTCTCGAGAAATGATTCGCTTGGCTTGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002944.2-3772s21c1
Sequence:CCGGTGATAATGAGATGGGATATTACTCGAGTAATATCCCATCTCATTATCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002944.2-3772s1c1
Sequence:CCGGTGATAATGAGATGGGATATTACTCGAGTAATATCCCATCTCATTATCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002944.2-788s1c1
Sequence:CCGGGCACCTTTGATTAGGAATATTCTCGAGAATATTCCTAATCAAAGGTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002944.2-1622s1c1
Sequence:CCGGCAAGTCTTCATGTCAACATTTCTCGAGAAATGTTGACATGAAGACTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002944.2-1144s1c1
Sequence:CCGGCCTTCGGTTGGATGCTATATACTCGAGTATATAGCATCCAACCGAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002944.2-4365s1c1
Sequence:CCGGCTGTGGATGGAGATCTTATATCTCGAGATATAAGATCTCCATCCACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)