EMAIL THIS PAGE TO A FRIEND

RP2

retinitis pigmentosa 2 (X-linked recessive)

30 Gene Product Result for
Synonyms: DELXp11.3 NM23-H10 NME10 TBCCD2 XRP2
UniProtKB ID: O75695, Q86XJ7, Q9NU67
Gene ID:
Human(6102) Summary: The RP2 locus has been implicated as one cause of X-linked retinitis pigmentosa. The predicted gene product shows homology with human cofactor C, a protein involved in the ultimate step of beta-tubulin folding. Progressive retinal degeneration may therefore be due to the accumulation of incorrectly-folded photoreceptor or neuron-specific tubulin isoforms followed by progressive cell death [provided by RefSeq, Jul 2008]
Rat(367714) retinitis pigmentosa 2 homolog (human)
Thale Cress(821293) pyruvate, phosphate dikinase regulatory protein 2
Horse(100060484) retinitis pigmentosa 2 (X-linked recessive)
domestic cat(101096879) retinitis pigmentosa 2 (X-linked recessive)
dog(491853) retinitis pigmentosa 2 (X-linked recessive)
Zebrafish(406755) retinitis pigmentosa 2 (X-linked recessive)
chicken(418675) retinitis pigmentosa 2 (X-linked recessive)
cow(534054) retinitis pigmentosa 2 (X-linked recessive)
sheep(101118420) retinitis pigmentosa 2 (X-linked recessive)
naked mole-rat(101713241) retinitis pigmentosa 2 (X-linked recessive)
domestic guinea pig(100724986) retinitis pigmentosa 2 (X-linked recessive)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006915 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006915 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006915 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046981 MISSION® esiRNA esiRNA human RP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006915 Rosetta Predictions human pricing
NM_001109012 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215597 predicted 440
2 SASI_Hs02_00342595 predicted 1272
3 SASI_Hs01_00215598 predicted 806
4 SASI_Hs01_00215599 predicted 529
5 SASI_Hs01_00215600 predicted 707
6 SASI_Hs01_00215602 predicted 363
7 SASI_Hs01_00215603 predicted 1058
8 SASI_Hs01_00215604 predicted 1151
9 SASI_Hs01_00215605 predicted 884
10 SASI_Hs01_00215606 predicted 427
11 SASI_Hs01_00215601 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109012 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244304 predicted 350
2 SASI_Rn02_00244305 predicted 525
3 SASI_Rn02_00244306 predicted 410
4 SASI_Rn02_00244307 predicted 573
5 SASI_Rn02_00244308 predicted 631
6 SASI_Rn02_00244309 predicted 783
7 SASI_Rn02_00244310 predicted 414
8 SASI_Rn02_00244311 predicted 291
9 SASI_Rn02_00244312 predicted 571
10 SASI_Rn02_00244313 predicted 887
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006915
VALIDATED
RP2 MISSION shRNA Bacterial Glycerol Stock
retinitis pigmentosa 2 (X-linked recessive)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006915.2-1110s21c1
Sequence:CCGGTGTAGAAGTATGTCAACTTATCTCGAGATAAGTTGACATACTTCTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006915.2-1208s21c1
Sequence:CCGGTCTACAACTTTGCTGATATACCTCGAGGTATATCAGCAAAGTTGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006915.2-1137s21c1
Sequence:CCGGCGAGATATTCAATGGGACCAACTCGAGTTGGTCCCATTGAATATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006915.2-2903s21c1
Sequence:CCGGGCTAAATTAAAGGGACTCCATCTCGAGATGGAGTCCCTTTAATTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006915.2-1154s21c1
Sequence:CCGGCCAAGATGTTTGTATCTGAAACTCGAGTTTCAGATACAAACATCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118797    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006915.1-2886s1c1
Sequence:CCGGGCTAAATTAAAGGGACTCCATCTCGAGATGGAGTCCCTTTAATTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006915.1-1137s1c1
Sequence:CCGGCCAAGATGTTTGTATCTGAAACTCGAGTTTCAGATACAAACATCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006915.1-884s1c1
Sequence:CCGGGTGGTATTATTTGCTGGTGATCTCGAGATCACCAGCAAATAATACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006915.1-673s1c1
Sequence:CCGGCGACAATACATGGAGTAACATCTCGAGATGTTACTCCATGTATTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006915.1-1120s1c1
Sequence:CCGGCGAGATATTCAATGGGACCAACTCGAGTTGGTCCCATTGAATATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006915
VALIDATED
RP2 MISSION shRNA shRNA Plasmid DNA
retinitis pigmentosa 2 (X-linked recessive)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006915.2-1110s21c1
Sequence:CCGGTGTAGAAGTATGTCAACTTATCTCGAGATAAGTTGACATACTTCTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006915.2-1208s21c1
Sequence:CCGGTCTACAACTTTGCTGATATACCTCGAGGTATATCAGCAAAGTTGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006915.2-1137s21c1
Sequence:CCGGCGAGATATTCAATGGGACCAACTCGAGTTGGTCCCATTGAATATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006915.2-2903s21c1
Sequence:CCGGGCTAAATTAAAGGGACTCCATCTCGAGATGGAGTCCCTTTAATTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006915.2-1154s21c1
Sequence:CCGGCCAAGATGTTTGTATCTGAAACTCGAGTTTCAGATACAAACATCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118797    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006915.1-2886s1c1
Sequence:CCGGGCTAAATTAAAGGGACTCCATCTCGAGATGGAGTCCCTTTAATTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006915.1-1137s1c1
Sequence:CCGGCCAAGATGTTTGTATCTGAAACTCGAGTTTCAGATACAAACATCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006915.1-884s1c1
Sequence:CCGGGTGGTATTATTTGCTGGTGATCTCGAGATCACCAGCAAATAATACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006915.1-673s1c1
Sequence:CCGGCGACAATACATGGAGTAACATCTCGAGATGTTACTCCATGTATTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006915.1-1120s1c1
Sequence:CCGGCGAGATATTCAATGGGACCAACTCGAGTTGGTCCCATTGAATATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006915
VALIDATED
RP2 MISSION shRNA Lentiviral Transduction Particles
retinitis pigmentosa 2 (X-linked recessive)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006915.2-1110s21c1
Sequence:CCGGTGTAGAAGTATGTCAACTTATCTCGAGATAAGTTGACATACTTCTACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006915.2-1208s21c1
Sequence:CCGGTCTACAACTTTGCTGATATACCTCGAGGTATATCAGCAAAGTTGTAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006915.2-1137s21c1
Sequence:CCGGCGAGATATTCAATGGGACCAACTCGAGTTGGTCCCATTGAATATCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006915.2-2903s21c1
Sequence:CCGGGCTAAATTAAAGGGACTCCATCTCGAGATGGAGTCCCTTTAATTTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006915.2-1154s21c1
Sequence:CCGGCCAAGATGTTTGTATCTGAAACTCGAGTTTCAGATACAAACATCTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118797    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006915.1-2886s1c1
Sequence:CCGGGCTAAATTAAAGGGACTCCATCTCGAGATGGAGTCCCTTTAATTTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006915.1-1137s1c1
Sequence:CCGGCCAAGATGTTTGTATCTGAAACTCGAGTTTCAGATACAAACATCTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006915.1-884s1c1
Sequence:CCGGGTGGTATTATTTGCTGGTGATCTCGAGATCACCAGCAAATAATACCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006915.1-673s1c1
Sequence:CCGGCGACAATACATGGAGTAACATCTCGAGATGTTACTCCATGTATTGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006915.1-1120s1c1
Sequence:CCGGCGAGATATTCAATGGGACCAACTCGAGTTGGTCCCATTGAATATCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)