EMAIL THIS PAGE TO A FRIEND

RPA3

replication protein A3, 14kDa

52 Gene Product Result for
Synonyms: REPA3
UniProtKB ID: P35244, Q549U6
Gene ID:
Mouse(68240) replication protein A3
Rat(296883) replication protein A3
Zebrafish(393196) replication protein A3
domestic cat(101097223) replication protein A3, 14kDa
dog(481449) replication protein A3, 14kDa
chicken(420578) replication protein A3, 14kDa
domestic guinea pig(100715065) replication protein A3, 14kDa
naked mole-rat(101708155) replication protein A3, 14kDa
cow(512754) replication protein A3, 14kDa
sheep(101121087) replication protein A3, 14kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026632 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026632 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026632 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002947 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002947 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002947 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002947 Rosetta Predictions human pricing
NM_001106584 Rosetta Predictions rat pricing
NM_026632 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143080 predicted 1206
2 SASI_Hs01_00143081 predicted 1208
3 SASI_Hs01_00143082 predicted 1205
4 SASI_Hs01_00143083 predicted 1267
5 SASI_Hs01_00143084 predicted 1212
6 SASI_Hs01_00143085 predicted 1201
7 SASI_Hs01_00143086 predicted 1209
8 SASI_Hs01_00143087 predicted 1227
9 SASI_Hs01_00143088 predicted 1184
10 SASI_Hs02_00334790 predicted 1314
11 SASI_Hs01_00143089 predicted 1370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106584 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220388 predicted 219
2 SASI_Rn02_00220389 predicted 199
3 SASI_Rn02_00220390 predicted 224
4 SASI_Rn02_00220391 predicted 250
5 SASI_Rn02_00220392 predicted 255
6 SASI_Rn02_00220393 predicted 232
7 SASI_Rn02_00220394 predicted 207
8 SASI_Rn02_00220395 predicted 249
9 SASI_Rn02_00220396 predicted 195
10 SASI_Rn02_00220397 predicted 213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026632 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063981 predicted 202
2 SASI_Mm01_00063983 predicted 242
3 SASI_Mm01_00063985 predicted 237
4 SASI_Mm01_00063987 predicted 200
5 SASI_Mm02_00330606 predicted 238
6 SASI_Mm02_00330607 predicted 207
7 SASI_Mm02_00330608 predicted 196
8 SASI_Mm02_00330609 predicted 230
9 SASI_Mm02_00330610 predicted 211
10 SASI_Mm01_00063978 predicted 257
11 SASI_Mm01_00063979 predicted 283
12 SASI_Mm01_00063980 predicted 255
13 SASI_Mm01_00063982 predicted 263
14 SASI_Mm01_00063984 predicted 247
15 SASI_Mm01_00063986 predicted 329
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026632
VALIDATED
RPA3 MISSION shRNA Bacterial Glycerol Stock
replication protein A3, 14kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026632.1-56s1c1
Sequence:CCGGGCCAGCATGTTACCACAGTATCTCGAGATACTGTGGTAACATGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026632.1-194s1c1
Sequence:CCGGGACGAGGAAATCTCTGGGATTCTCGAGAATCCCAGAGATTTCCTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026632.1-457s1c1
Sequence:CCGGGCGACTCCTATAATTTCTAATCTCGAGATTAGAAATTATAGGAGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026632.1-270s1c1
Sequence:CCGGCCCTGTTTAAGGAAGATACTACTCGAGTAGTATCTTCCTTAAACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026632.1-249s1c1
Sequence:CCGGCCGTGCTCTGTGCATCTTATACTCGAGTATAAGATGCACAGAGCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026632.4-308s21c1
Sequence:CCGGGAAGATACTAATCGCTTTGATCTCGAGATCAAAGCGATTAGTATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026632.4-276s21c1
Sequence:CCGGCCGTGCTCTGTGCATCTTATACTCGAGTATAAGATGCACAGAGCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026632.4-297s21c1
Sequence:CCGGCCCTGTTTAAGGAAGATACTACTCGAGTAGTATCTTCCTTAAACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026632.4-441s21c1
Sequence:CCGGCTACACTGAAGGCTATTAAGGCTCGAGCCTTAATAGCCTTCAGTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026632.4-484s21c1
Sequence:CCGGGCGACTCCTATAATTTCTAATCTCGAGATTAGAAATTATAGGAGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026632
VALIDATED
RPA3 MISSION shRNA shRNA Plasmid DNA
replication protein A3, 14kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026632.1-56s1c1
Sequence:CCGGGCCAGCATGTTACCACAGTATCTCGAGATACTGTGGTAACATGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026632.1-194s1c1
Sequence:CCGGGACGAGGAAATCTCTGGGATTCTCGAGAATCCCAGAGATTTCCTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026632.1-457s1c1
Sequence:CCGGGCGACTCCTATAATTTCTAATCTCGAGATTAGAAATTATAGGAGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026632.1-270s1c1
Sequence:CCGGCCCTGTTTAAGGAAGATACTACTCGAGTAGTATCTTCCTTAAACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026632.1-249s1c1
Sequence:CCGGCCGTGCTCTGTGCATCTTATACTCGAGTATAAGATGCACAGAGCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026632.4-308s21c1
Sequence:CCGGGAAGATACTAATCGCTTTGATCTCGAGATCAAAGCGATTAGTATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026632.4-276s21c1
Sequence:CCGGCCGTGCTCTGTGCATCTTATACTCGAGTATAAGATGCACAGAGCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026632.4-297s21c1
Sequence:CCGGCCCTGTTTAAGGAAGATACTACTCGAGTAGTATCTTCCTTAAACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026632.4-441s21c1
Sequence:CCGGCTACACTGAAGGCTATTAAGGCTCGAGCCTTAATAGCCTTCAGTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026632.4-484s21c1
Sequence:CCGGGCGACTCCTATAATTTCTAATCTCGAGATTAGAAATTATAGGAGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026632
VALIDATED
RPA3 MISSION shRNA Lentiviral Transduction Particles
replication protein A3, 14kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026632.1-56s1c1
Sequence:CCGGGCCAGCATGTTACCACAGTATCTCGAGATACTGTGGTAACATGCTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026632.1-194s1c1
Sequence:CCGGGACGAGGAAATCTCTGGGATTCTCGAGAATCCCAGAGATTTCCTCGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026632.1-457s1c1
Sequence:CCGGGCGACTCCTATAATTTCTAATCTCGAGATTAGAAATTATAGGAGTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026632.1-270s1c1
Sequence:CCGGCCCTGTTTAAGGAAGATACTACTCGAGTAGTATCTTCCTTAAACAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026632.1-249s1c1
Sequence:CCGGCCGTGCTCTGTGCATCTTATACTCGAGTATAAGATGCACAGAGCACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026632.4-308s21c1
Sequence:CCGGGAAGATACTAATCGCTTTGATCTCGAGATCAAAGCGATTAGTATCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026632.4-276s21c1
Sequence:CCGGCCGTGCTCTGTGCATCTTATACTCGAGTATAAGATGCACAGAGCACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026632.4-297s21c1
Sequence:CCGGCCCTGTTTAAGGAAGATACTACTCGAGTAGTATCTTCCTTAAACAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026632.4-441s21c1
Sequence:CCGGCTACACTGAAGGCTATTAAGGCTCGAGCCTTAATAGCCTTCAGTGTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026632.4-484s21c1
Sequence:CCGGGCGACTCCTATAATTTCTAATCTCGAGATTAGAAATTATAGGAGTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002947
VALIDATED
RPA3 MISSION shRNA Bacterial Glycerol Stock
replication protein A3, 14kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_002947.3-1414s21c1
Sequence:CCGGGTACATCTTATGTCCAGTTTACTCGAGTAAACTGGACATAAGATGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_002947.2-1371s1c1
Sequence:CCGGTCTGGAATTGTGGAAGTGGTTCTCGAGAACCACTTCCACAATTCCAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002947.2-1229s1c1
Sequence:CCGGGCTAGCTCAATTCATCGACAACTCGAGTTGTCGATGAATTGAGCTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002947.2-1423s1c1
Sequence:CCGGGTACATCTTATGTCCAGTTTACTCGAGTAAACTGGACATAAGATGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_002947.2-1411s1c1
Sequence:CCGGCCACCATCTTGTGTACATCTTCTCGAGAAGATGTACACAAGATGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002947.2-1464s1c1
Sequence:CCGGGATCTTGGACTTTACAATGAACTCGAGTTCATTGTAAAGTCCAAGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002947.3-1455s21c1
Sequence:CCGGGATCTTGGACTTTACAATGAACTCGAGTTCATTGTAAAGTCCAAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002947.3-1402s21c1
Sequence:CCGGCCACCATCTTGTGTACATCTTCTCGAGAAGATGTACACAAGATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002947.3-1220s21c1
Sequence:CCGGGCTAGCTCAATTCATCGACAACTCGAGTTGTCGATGAATTGAGCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002947
VALIDATED
RPA3 MISSION shRNA shRNA Plasmid DNA
replication protein A3, 14kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_002947.3-1414s21c1
Sequence:CCGGGTACATCTTATGTCCAGTTTACTCGAGTAAACTGGACATAAGATGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_002947.2-1371s1c1
Sequence:CCGGTCTGGAATTGTGGAAGTGGTTCTCGAGAACCACTTCCACAATTCCAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002947.2-1229s1c1
Sequence:CCGGGCTAGCTCAATTCATCGACAACTCGAGTTGTCGATGAATTGAGCTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002947.2-1423s1c1
Sequence:CCGGGTACATCTTATGTCCAGTTTACTCGAGTAAACTGGACATAAGATGTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_002947.2-1411s1c1
Sequence:CCGGCCACCATCTTGTGTACATCTTCTCGAGAAGATGTACACAAGATGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002947.2-1464s1c1
Sequence:CCGGGATCTTGGACTTTACAATGAACTCGAGTTCATTGTAAAGTCCAAGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002947.3-1455s21c1
Sequence:CCGGGATCTTGGACTTTACAATGAACTCGAGTTCATTGTAAAGTCCAAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002947.3-1402s21c1
Sequence:CCGGCCACCATCTTGTGTACATCTTCTCGAGAAGATGTACACAAGATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002947.3-1220s21c1
Sequence:CCGGGCTAGCTCAATTCATCGACAACTCGAGTTGTCGATGAATTGAGCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002947
VALIDATED
RPA3 MISSION shRNA Lentiviral Transduction Particles
replication protein A3, 14kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_002947.3-1414s21c1
Sequence:CCGGGTACATCTTATGTCCAGTTTACTCGAGTAAACTGGACATAAGATGTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_002947.2-1371s1c1
Sequence:CCGGTCTGGAATTGTGGAAGTGGTTCTCGAGAACCACTTCCACAATTCCAGATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002947.2-1229s1c1
Sequence:CCGGGCTAGCTCAATTCATCGACAACTCGAGTTGTCGATGAATTGAGCTAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002947.2-1423s1c1
Sequence:CCGGGTACATCTTATGTCCAGTTTACTCGAGTAAACTGGACATAAGATGTACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_002947.2-1411s1c1
Sequence:CCGGCCACCATCTTGTGTACATCTTCTCGAGAAGATGTACACAAGATGGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002947.2-1464s1c1
Sequence:CCGGGATCTTGGACTTTACAATGAACTCGAGTTCATTGTAAAGTCCAAGATCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002947.3-1455s21c1
Sequence:CCGGGATCTTGGACTTTACAATGAACTCGAGTTCATTGTAAAGTCCAAGATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002947.3-1402s21c1
Sequence:CCGGCCACCATCTTGTGTACATCTTCTCGAGAAGATGTACACAAGATGGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002947.3-1220s21c1
Sequence:CCGGGCTAGCTCAATTCATCGACAACTCGAGTTGTCGATGAATTGAGCTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)