EMAIL THIS PAGE TO A FRIEND

RPAIN

RPA interacting protein

65 Gene Product Result for
Synonyms: HRIP RIP
Gene ID:
Mouse(69723) RPA interacting protein
Rat(287463) RPA interacting protein
Zebrafish(751671) RPA interacting protein
domestic cat(101089809) RPA interacting protein
dog(607256) RPA interacting protein
chicken(417500) RPA interacting protein
cow(618324) RPA interacting protein
sheep(101106272) RPA interacting protein
naked mole-rat(101696920) RPA interacting protein
domestic guinea pig(100725633) RPA interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032308 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032308 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032308 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027186 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027186 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027186 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033002 Rosetta Predictions human pricing
NM_032308 Rosetta Predictions human pricing
NM_001033060 Rosetta Predictions rat pricing
NM_027186 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033002 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131645 predicted 1089
2 SASI_Hs01_00131646 predicted 876
3 SASI_Hs01_00131647 predicted 775
4 SASI_Hs01_00131648 predicted 972
5 SASI_Hs01_00131649 predicted 737
6 SASI_Hs01_00131651 predicted 764
7 SASI_Hs02_00307963 predicted 709
8 SASI_Hs01_00131652 predicted 987
9 SASI_Hs01_00131653 predicted 972
10 SASI_Hs01_00131654 predicted 889
11 SASI_Hs01_00131650 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032308 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164246 predicted 461
2 SASI_Hs01_00164247 predicted 470
3 SASI_Hs01_00164248 predicted 432
4 SASI_Hs01_00164249 predicted 411
5 SASI_Hs01_00164250 predicted 324
6 SASI_Hs01_00164251 predicted 220
7 SASI_Hs01_00164252 predicted 293
8 SASI_Hs01_00164253 predicted 469
9 SASI_Hs01_00164254 predicted 206
10 SASI_Hs01_00164255 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033060 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090503 predicted 202
2 SASI_Rn01_00090504 predicted 473
3 SASI_Rn01_00090505 predicted 200
4 SASI_Rn01_00090506 predicted 288
5 SASI_Rn01_00090507 predicted 192
6 SASI_Rn01_00090508 predicted 231
7 SASI_Rn01_00090509 predicted 340
8 SASI_Rn01_00090510 predicted 327
9 SASI_Rn01_00090511 predicted 473
10 SASI_Rn01_00090512 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027186 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116005 predicted 455
2 SASI_Mm01_00116006 predicted 465
3 SASI_Mm01_00116007 predicted 352
4 SASI_Mm01_00116008 predicted 467
5 SASI_Mm01_00116009 predicted 801
6 SASI_Mm01_00116010 predicted 769
7 SASI_Mm01_00116011 predicted 379
8 SASI_Mm01_00116012 predicted 613
9 SASI_Mm01_00116013 predicted 700
10 SASI_Mm01_00116014 predicted 534
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032308
VALIDATED
RPAIN MISSION shRNA Bacterial Glycerol Stock
RPA interacting protein
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032308.1-220s1c1
Sequence:CCGGGAATGCTTTGCAGTCAGTGGACTCGAGTCCACTGACTGCAAAGCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032308.1-179s1c1
Sequence:CCGGCAGAACAGCTTTCTAGTTCAACTCGAGTTGAACTAGAAAGCTGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032308.1-615s1c1
Sequence:CCGGGCTTGGACTCACATCATTCTACTCGAGTAGAATGATGTGAGTCCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032308.1-316s1c1
Sequence:CCGGGATCAACCAAGAGCAGTCCATCTCGAGATGGACTGCTCTTGGTTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032308.1-749s1c1
Sequence:CCGGCGACATCTGTTCTTGGTCTTTCTCGAGAAAGACCAAGAACAGATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168627    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032308.1-469s1c1
Sequence:CCGGGCCTGTTTAGAGGGTAGTATACTCGAGTATACTACCCTCTAAACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032308
VALIDATED
RPAIN MISSION shRNA shRNA Plasmid DNA
RPA interacting protein
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032308.1-220s1c1
Sequence:CCGGGAATGCTTTGCAGTCAGTGGACTCGAGTCCACTGACTGCAAAGCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032308.1-179s1c1
Sequence:CCGGCAGAACAGCTTTCTAGTTCAACTCGAGTTGAACTAGAAAGCTGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032308.1-615s1c1
Sequence:CCGGGCTTGGACTCACATCATTCTACTCGAGTAGAATGATGTGAGTCCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032308.1-316s1c1
Sequence:CCGGGATCAACCAAGAGCAGTCCATCTCGAGATGGACTGCTCTTGGTTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032308.1-749s1c1
Sequence:CCGGCGACATCTGTTCTTGGTCTTTCTCGAGAAAGACCAAGAACAGATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168627    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032308.1-469s1c1
Sequence:CCGGGCCTGTTTAGAGGGTAGTATACTCGAGTATACTACCCTCTAAACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032308
VALIDATED
RPAIN MISSION shRNA Lentiviral Transduction Particles
RPA interacting protein
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032308.1-220s1c1
Sequence:CCGGGAATGCTTTGCAGTCAGTGGACTCGAGTCCACTGACTGCAAAGCATTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032308.1-179s1c1
Sequence:CCGGCAGAACAGCTTTCTAGTTCAACTCGAGTTGAACTAGAAAGCTGTTCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032308.1-615s1c1
Sequence:CCGGGCTTGGACTCACATCATTCTACTCGAGTAGAATGATGTGAGTCCAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032308.1-316s1c1
Sequence:CCGGGATCAACCAAGAGCAGTCCATCTCGAGATGGACTGCTCTTGGTTGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032308.1-749s1c1
Sequence:CCGGCGACATCTGTTCTTGGTCTTTCTCGAGAAAGACCAAGAACAGATGTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168627    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032308.1-469s1c1
Sequence:CCGGGCCTGTTTAGAGGGTAGTATACTCGAGTATACTACCCTCTAAACAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027186
RPAIN MISSION shRNA Bacterial Glycerol Stock
RPA interacting protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027186.1-630s1c1
Sequence:CCGGCGAAGAGGACTTAGAGTTTGACTCGAGTCAAACTCTAAGTCCTCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027186.1-634s1c1
Sequence:CCGGGAGGACTTAGAGTTTGATGAACTCGAGTTCATCAAACTCTAAGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027186.1-405s1c1
Sequence:CCGGGCACAGGCTCCTGAACAAATACTCGAGTATTTGTTCAGGAGCCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027186.1-477s1c1
Sequence:CCGGGCAAGAAGTAATGGAGGAAGACTCGAGTCTTCCTCCATTACTTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027186.1-897s1c1
Sequence:CCGGGAAGCCCAGTCTTCTGATGAACTCGAGTTCATCAGAAGACTGGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027186
RPAIN MISSION shRNA shRNA Plasmid DNA
RPA interacting protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027186.1-630s1c1
Sequence:CCGGCGAAGAGGACTTAGAGTTTGACTCGAGTCAAACTCTAAGTCCTCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027186.1-634s1c1
Sequence:CCGGGAGGACTTAGAGTTTGATGAACTCGAGTTCATCAAACTCTAAGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027186.1-405s1c1
Sequence:CCGGGCACAGGCTCCTGAACAAATACTCGAGTATTTGTTCAGGAGCCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027186.1-477s1c1
Sequence:CCGGGCAAGAAGTAATGGAGGAAGACTCGAGTCTTCCTCCATTACTTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027186.1-897s1c1
Sequence:CCGGGAAGCCCAGTCTTCTGATGAACTCGAGTTCATCAGAAGACTGGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027186
RPAIN MISSION shRNA Lentiviral Transduction Particles
RPA interacting protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027186.1-630s1c1
Sequence:CCGGCGAAGAGGACTTAGAGTTTGACTCGAGTCAAACTCTAAGTCCTCTTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027186.1-634s1c1
Sequence:CCGGGAGGACTTAGAGTTTGATGAACTCGAGTTCATCAAACTCTAAGTCCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027186.1-405s1c1
Sequence:CCGGGCACAGGCTCCTGAACAAATACTCGAGTATTTGTTCAGGAGCCTGTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027186.1-477s1c1
Sequence:CCGGGCAAGAAGTAATGGAGGAAGACTCGAGTCTTCCTCCATTACTTCTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027186.1-897s1c1
Sequence:CCGGGAAGCCCAGTCTTCTGATGAACTCGAGTTCATCAGAAGACTGGGCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)