EMAIL THIS PAGE TO A FRIEND

RPAP2

RNA polymerase II associated protein 2

80 Gene Product Result for
Synonyms: C1orf82
UniProtKB ID: Q8IXW5, C9JKB5, Q49AS7, Q9H8Y2
Gene ID:
Mouse(231571) RNA polymerase II associated protein 2
Rat(305120) RNA polymerase II associated protein 2
Zebrafish(554138) RNA polymerase II associated protein 2
domestic cat(101097410) RNA polymerase II associated protein 2
dog(612366) RNA polymerase II associated protein 2
chicken(424501) RNA polymerase II associated protein 2
cow(529184) RNA polymerase II associated protein 2
sheep(101103936) RNA polymerase II associated protein 2
Domestic Rabbit(100354958) RNA polymerase II associated protein 2
naked mole-rat(101698319) RNA polymerase II associated protein 2
domestic guinea pig(100721025) RNA polymerase II associated protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024813 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024813 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024813 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144911 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144911 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144911 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024813 Rosetta Predictions human pricing
NM_001013987 Rosetta Predictions rat pricing
NM_144911 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081549 predicted 296
2 SASI_Hs01_00081551 predicted 570
3 SASI_Hs02_00357363 predicted 1627
4 SASI_Hs02_00357364 predicted 321
5 SASI_Hs02_00357365 predicted 566
6 SASI_Hs01_00081553 predicted 913
7 SASI_Hs01_00081555 predicted 1887
8 SASI_Hs01_00081556 predicted 878
9 SASI_Hs01_00081557 predicted 290
10 SASI_Hs01_00081558 predicted 1841
11 SASI_Hs01_00081550 predicted 1589
12 SASI_Hs01_00081552 predicted 1640
13 SASI_Hs01_00081554 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013987 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057751 predicted 1257
2 SASI_Rn01_00057752 predicted 1526
3 SASI_Rn01_00057753 predicted 1017
4 SASI_Rn01_00057754 predicted 1006
5 SASI_Rn01_00057755 predicted 750
6 SASI_Rn01_00057756 predicted 1138
7 SASI_Rn01_00057757 predicted 1851
8 SASI_Rn02_00201339 predicted 860
9 SASI_Rn01_00057759 predicted 1618
10 SASI_Rn01_00057760 predicted 255
11 SASI_Rn01_00057758 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144911 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340385 predicted 953
2 SASI_Mm02_00340386 predicted 871
3 SASI_Mm02_00340387 predicted 1134
4 SASI_Mm02_00340388 predicted 1741
5 SASI_Mm02_00340389 predicted 223
6 SASI_Mm01_00160708 predicted 1078
7 SASI_Mm02_00340390 predicted 1393
8 SASI_Mm02_00340391 predicted 301
9 SASI_Mm02_00340392 predicted 338
10 SASI_Mm02_00340393 predicted 891
11 SASI_Mm01_00160702 predicted 551
12 SASI_Mm01_00160703 predicted 451
13 SASI_Mm01_00160704 predicted 1981
14 SASI_Mm01_00160705 predicted 971
15 SASI_Mm01_00160706 predicted 549
16 SASI_Mm01_00160707 predicted 546
17 SASI_Mm01_00160709 predicted 449
18 SASI_Mm01_00160710 predicted 394
19 SASI_Mm01_00160711 predicted 1493
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024813
RPAP2 MISSION shRNA Bacterial Glycerol Stock
RNA polymerase II associated protein 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024813.1-2212s1c1
Sequence:CCGGCCATCATATCAGTTTGCCAAACTCGAGTTTGGCAAACTGATATGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024813.1-686s1c1
Sequence:CCGGGCAAGACTTTGTTTCCTCCATCTCGAGATGGAGGAAACAAAGTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024813.1-1364s1c1
Sequence:CCGGGCCAAGTTACGAGAATTTGAACTCGAGTTCAAATTCTCGTAACTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024813.1-2211s1c1
Sequence:CCGGGCCATCATATCAGTTTGCCAACTCGAGTTGGCAAACTGATATGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024813.1-788s1c1
Sequence:CCGGCAAAGCTAACTCCAAACACAACTCGAGTTGTGTTTGGAGTTAGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024813.2-1756s21c1
Sequence:CCGGACCTGCGGAATGGACTTTAATCTCGAGATTAAAGTCCATTCCGCAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024813
RPAP2 MISSION shRNA shRNA Plasmid DNA
RNA polymerase II associated protein 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024813.1-2212s1c1
Sequence:CCGGCCATCATATCAGTTTGCCAAACTCGAGTTTGGCAAACTGATATGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024813.1-686s1c1
Sequence:CCGGGCAAGACTTTGTTTCCTCCATCTCGAGATGGAGGAAACAAAGTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024813.1-1364s1c1
Sequence:CCGGGCCAAGTTACGAGAATTTGAACTCGAGTTCAAATTCTCGTAACTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024813.1-2211s1c1
Sequence:CCGGGCCATCATATCAGTTTGCCAACTCGAGTTGGCAAACTGATATGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024813.1-788s1c1
Sequence:CCGGCAAAGCTAACTCCAAACACAACTCGAGTTGTGTTTGGAGTTAGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024813.2-1756s21c1
Sequence:CCGGACCTGCGGAATGGACTTTAATCTCGAGATTAAAGTCCATTCCGCAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024813
RPAP2 MISSION shRNA Lentiviral Transduction Particles
RNA polymerase II associated protein 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024813.1-2212s1c1
Sequence:CCGGCCATCATATCAGTTTGCCAAACTCGAGTTTGGCAAACTGATATGATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024813.1-686s1c1
Sequence:CCGGGCAAGACTTTGTTTCCTCCATCTCGAGATGGAGGAAACAAAGTCTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024813.1-1364s1c1
Sequence:CCGGGCCAAGTTACGAGAATTTGAACTCGAGTTCAAATTCTCGTAACTTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024813.1-2211s1c1
Sequence:CCGGGCCATCATATCAGTTTGCCAACTCGAGTTGGCAAACTGATATGATGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024813.1-788s1c1
Sequence:CCGGCAAAGCTAACTCCAAACACAACTCGAGTTGTGTTTGGAGTTAGCTTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024813.2-1756s21c1
Sequence:CCGGACCTGCGGAATGGACTTTAATCTCGAGATTAAAGTCCATTCCGCAGGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144911
VALIDATED
RPAP2 MISSION shRNA Bacterial Glycerol Stock
RNA polymerase II associated protein 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144911.2-1292s21c1
Sequence:CCGGACTTGATGAAGATGACATAAGCTCGAGCTTATGTCATCTTCATCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144911.2-1843s21c1
Sequence:CCGGCCCTGCTGACAGAATTGCATTCTCGAGAATGCAATTCTGTCAGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144911.2-1651s21c1
Sequence:CCGGAGATTACAATGGGAGATATTTCTCGAGAAATATCTCCCATTGTAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144911.2-2002s21c1
Sequence:CCGGGACTGATGACTAAGTGTGTAACTCGAGTTACACACTTAGTCATCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144911.1-1825s1c1
Sequence:CCGGCCCTGCTGACAGAATTGCATTCTCGAGAATGCAATTCTGTCAGCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176077    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144911.1-2036s1c1
Sequence:CCGGGCAAGAAGGAAGCTCTTACATCTCGAGATGTAAGAGCTTCCTTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174992    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144911.1-1984s1c1
Sequence:CCGGGACTGATGACTAAGTGTGTAACTCGAGTTACACACTTAGTCATCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144911.1-360s1c1
Sequence:CCGGCCTTTGTGTCAGAAGAAGCTACTCGAGTAGCTTCTTCTGACACAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144911.2-132s21c1
Sequence:CCGGCGAGATGCTACCGGTACTAAACTCGAGTTTAGTACCGGTAGCATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144911
VALIDATED
RPAP2 MISSION shRNA shRNA Plasmid DNA
RNA polymerase II associated protein 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144911.2-1292s21c1
Sequence:CCGGACTTGATGAAGATGACATAAGCTCGAGCTTATGTCATCTTCATCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144911.2-1843s21c1
Sequence:CCGGCCCTGCTGACAGAATTGCATTCTCGAGAATGCAATTCTGTCAGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144911.2-1651s21c1
Sequence:CCGGAGATTACAATGGGAGATATTTCTCGAGAAATATCTCCCATTGTAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144911.2-2002s21c1
Sequence:CCGGGACTGATGACTAAGTGTGTAACTCGAGTTACACACTTAGTCATCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144911.1-1825s1c1
Sequence:CCGGCCCTGCTGACAGAATTGCATTCTCGAGAATGCAATTCTGTCAGCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176077    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144911.1-2036s1c1
Sequence:CCGGGCAAGAAGGAAGCTCTTACATCTCGAGATGTAAGAGCTTCCTTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174992    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144911.1-1984s1c1
Sequence:CCGGGACTGATGACTAAGTGTGTAACTCGAGTTACACACTTAGTCATCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144911.1-360s1c1
Sequence:CCGGCCTTTGTGTCAGAAGAAGCTACTCGAGTAGCTTCTTCTGACACAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144911.2-132s21c1
Sequence:CCGGCGAGATGCTACCGGTACTAAACTCGAGTTTAGTACCGGTAGCATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144911
VALIDATED
RPAP2 MISSION shRNA Lentiviral Transduction Particles
RNA polymerase II associated protein 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144911.2-1292s21c1
Sequence:CCGGACTTGATGAAGATGACATAAGCTCGAGCTTATGTCATCTTCATCAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144911.2-1843s21c1
Sequence:CCGGCCCTGCTGACAGAATTGCATTCTCGAGAATGCAATTCTGTCAGCAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144911.2-1651s21c1
Sequence:CCGGAGATTACAATGGGAGATATTTCTCGAGAAATATCTCCCATTGTAATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144911.2-2002s21c1
Sequence:CCGGGACTGATGACTAAGTGTGTAACTCGAGTTACACACTTAGTCATCAGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144911.1-1825s1c1
Sequence:CCGGCCCTGCTGACAGAATTGCATTCTCGAGAATGCAATTCTGTCAGCAGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176077    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144911.1-2036s1c1
Sequence:CCGGGCAAGAAGGAAGCTCTTACATCTCGAGATGTAAGAGCTTCCTTCTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174992    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144911.1-1984s1c1
Sequence:CCGGGACTGATGACTAAGTGTGTAACTCGAGTTACACACTTAGTCATCAGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144911.1-360s1c1
Sequence:CCGGCCTTTGTGTCAGAAGAAGCTACTCGAGTAGCTTCTTCTGACACAAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144911.2-132s21c1
Sequence:CCGGCGAGATGCTACCGGTACTAAACTCGAGTTTAGTACCGGTAGCATCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)