EMAIL THIS PAGE TO A FRIEND

RPAP3

RNA polymerase II associated protein 3

51 Gene Product Result for
UniProtKB ID: Q9H6T3, B4DRW9, Q6PHR5
Gene ID:
Human(79657) Summary: This gene encodes an RNA polymerase II-associated protein. The encoded protein may function in transcriptional regulation and may also regulate apoptosis. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
Mouse(71919) RNA polymerase II associated protein 3
Rat(300189) RNA polymerase II associated protein 3
Zebrafish(393173) RNA polymerase II associated protein 3
Horse(100056477) RNA polymerase II associated protein 3
domestic cat(101084550) RNA polymerase II associated protein 3
dog(477631) RNA polymerase II associated protein 3
chicken(417811) RNA polymerase II associated protein 3
domestic guinea pig(100712670) RNA polymerase II associated protein 3
naked mole-rat(101715669) RNA polymerase II associated protein 3
cow(510621) RNA polymerase II associated protein 3
sheep(101110665) RNA polymerase II associated protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024604 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024604 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024604 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028003 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028003 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028003 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024604 Rosetta Predictions human pricing
NM_001004243 Rosetta Predictions rat pricing
NM_028003 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245762 predicted 1009
2 SASI_Hs01_00245763 predicted 1806
3 SASI_Hs01_00245764 predicted 1200
4 SASI_Hs01_00245765 predicted 1769
5 SASI_Hs01_00245766 predicted 1577
6 SASI_Hs01_00245767 predicted 1646
7 SASI_Hs01_00245768 predicted 1076
8 SASI_Hs01_00245770 predicted 1999
9 SASI_Hs01_00245771 predicted 1247
10 SASI_Hs02_00356967 predicted 997
11 SASI_Hs01_00245769 predicted 1418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004243 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104715 predicted 1260
2 SASI_Rn01_00104716 predicted 1045
3 SASI_Rn01_00104717 predicted 605
4 SASI_Rn01_00104719 predicted 654
5 SASI_Rn01_00104720 predicted 1046
6 SASI_Rn02_00198252 predicted 638
7 SASI_Rn01_00104721 predicted 719
8 SASI_Rn01_00104722 predicted 586
9 SASI_Rn01_00104723 predicted 972
10 SASI_Rn01_00104724 predicted 908
11 SASI_Rn01_00104718 predicted 1723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028003 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178555 predicted 473
2 SASI_Mm01_00178556 predicted 597
3 SASI_Mm01_00178557 predicted 656
4 SASI_Mm02_00333099 predicted 764
5 SASI_Mm01_00178558 predicted 1792
6 SASI_Mm01_00178559 predicted 980
7 SASI_Mm01_00178560 predicted 1117
8 SASI_Mm01_00178561 predicted 1840
9 SASI_Mm01_00178562 predicted 345
10 SASI_Mm01_00178563 predicted 1046
11 SASI_Mm01_00178564 predicted 545
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024604
VALIDATED
RPAP3 MISSION shRNA Bacterial Glycerol Stock
RNA polymerase II associated protein 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_024604.1-853s21c1
Sequence:CCGGGCGAAAGCAAATTGAAGCACACTCGAGTGTGCTTCAATTTGCTTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024604.1-110s1c1
Sequence:CCGGCAAGACTTTATGCGGGATTTACTCGAGTAAATCCCGCATAAAGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024604.1-782s1c1
Sequence:CCGGCAGGCTTTAGCATCCAAAGAACTCGAGTTCTTTGGATGCTAAAGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024604.1-532s1c1
Sequence:CCGGCGATCCATATAATCCCGTGTTCTCGAGAACACGGGATTATATGGATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024604.1-362s1c1
Sequence:CCGGGACAAAGACGATAGTACCCATCTCGAGATGGGTACTATCGTCTTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_024604.1-1355s21c1
Sequence:CCGGATTGAAGAAACTGGTAATTTGCTCGAGCAAATTACCAGTTTCTTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_024604.1-1417s21c1
Sequence:CCGGTCCAGAGAATAATCCTATTAACTCGAGTTAATAGGATTATTCTCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024604.1-1316s21c1
Sequence:CCGGCCGCATCCTGGATCAACTAAACTCGAGTTTAGTTGATCCAGGATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_024604.1-247s1c1
Sequence:CCGGCAAAGCTAAAGAGTCTTCCAACTCGAGTTGGAAGACTCTTTAGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_024604.1-1734s21c1
Sequence:CCGGCAGATATGTTGTATCAGTATTCTCGAGAATACTGATACAACATATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024604.1-1811s1c1
Sequence:CCGGGATGTATTCAACCAGATCGTTCTCGAGAACGATCTGGTTGAATACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_024604.1-853s1c1
Sequence:CCGGGCGAAAGCAAATTGAAGCACACTCGAGTGTGCTTCAATTTGCTTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024604
VALIDATED
RPAP3 MISSION shRNA shRNA Plasmid DNA
RNA polymerase II associated protein 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_024604.1-853s21c1
Sequence:CCGGGCGAAAGCAAATTGAAGCACACTCGAGTGTGCTTCAATTTGCTTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024604.1-110s1c1
Sequence:CCGGCAAGACTTTATGCGGGATTTACTCGAGTAAATCCCGCATAAAGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024604.1-782s1c1
Sequence:CCGGCAGGCTTTAGCATCCAAAGAACTCGAGTTCTTTGGATGCTAAAGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024604.1-532s1c1
Sequence:CCGGCGATCCATATAATCCCGTGTTCTCGAGAACACGGGATTATATGGATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024604.1-362s1c1
Sequence:CCGGGACAAAGACGATAGTACCCATCTCGAGATGGGTACTATCGTCTTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_024604.1-1355s21c1
Sequence:CCGGATTGAAGAAACTGGTAATTTGCTCGAGCAAATTACCAGTTTCTTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_024604.1-1417s21c1
Sequence:CCGGTCCAGAGAATAATCCTATTAACTCGAGTTAATAGGATTATTCTCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024604.1-1316s21c1
Sequence:CCGGCCGCATCCTGGATCAACTAAACTCGAGTTTAGTTGATCCAGGATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_024604.1-247s1c1
Sequence:CCGGCAAAGCTAAAGAGTCTTCCAACTCGAGTTGGAAGACTCTTTAGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_024604.1-1734s21c1
Sequence:CCGGCAGATATGTTGTATCAGTATTCTCGAGAATACTGATACAACATATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024604.1-1811s1c1
Sequence:CCGGGATGTATTCAACCAGATCGTTCTCGAGAACGATCTGGTTGAATACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_024604.1-853s1c1
Sequence:CCGGGCGAAAGCAAATTGAAGCACACTCGAGTGTGCTTCAATTTGCTTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024604
VALIDATED
RPAP3 MISSION shRNA Lentiviral Transduction Particles
RNA polymerase II associated protein 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_024604.1-853s21c1
Sequence:CCGGGCGAAAGCAAATTGAAGCACACTCGAGTGTGCTTCAATTTGCTTTCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000146306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024604.1-110s1c1
Sequence:CCGGCAAGACTTTATGCGGGATTTACTCGAGTAAATCCCGCATAAAGTCTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000146386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024604.1-782s1c1
Sequence:CCGGCAGGCTTTAGCATCCAAAGAACTCGAGTTCTTTGGATGCTAAAGCCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000148363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024604.1-532s1c1
Sequence:CCGGCGATCCATATAATCCCGTGTTCTCGAGAACACGGGATTATATGGATCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000149089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024604.1-362s1c1
Sequence:CCGGGACAAAGACGATAGTACCCATCTCGAGATGGGTACTATCGTCTTTGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000274943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_024604.1-1355s21c1
Sequence:CCGGATTGAAGAAACTGGTAATTTGCTCGAGCAAATTACCAGTTTCTTCAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000274941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_024604.1-1417s21c1
Sequence:CCGGTCCAGAGAATAATCCTATTAACTCGAGTTAATAGGATTATTCTCTGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000275009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024604.1-1316s21c1
Sequence:CCGGCCGCATCCTGGATCAACTAAACTCGAGTTTAGTTGATCCAGGATGCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000129782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_024604.1-247s1c1
Sequence:CCGGCAAAGCTAAAGAGTCTTCCAACTCGAGTTGGAAGACTCTTTAGCTTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000274942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_024604.1-1734s21c1
Sequence:CCGGCAGATATGTTGTATCAGTATTCTCGAGAATACTGATACAACATATCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000130055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024604.1-1811s1c1
Sequence:CCGGGATGTATTCAACCAGATCGTTCTCGAGAACGATCTGGTTGAATACATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000127963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_024604.1-853s1c1
Sequence:CCGGGCGAAAGCAAATTGAAGCACACTCGAGTGTGCTTCAATTTGCTTTCGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028003
VALIDATED
RPAP3 MISSION shRNA Bacterial Glycerol Stock
RNA polymerase II associated protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028003.2-243s21c1
Sequence:CCGGATTTACCTCCTATTCGAAATGCTCGAGCATTTCGAATAGGAGGTAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028003.2-1834s21c1
Sequence:CCGGTCCAGATGTATTCAATCAAATCTCGAGATTTGATTGAATACATCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028003.2-671s21c1
Sequence:CCGGATCGCCTTGAGCAGGACTTACCTCGAGGTAAGTCCTGCTCAAGGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028003.2-2090s21c1
Sequence:CCGGGCCGCCTCTGTGTACATTATTCTCGAGAATAATGTACACAGAGGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028003.2-1761s21c1
Sequence:CCGGCAGAGATGCTGTATCAGTATGCTCGAGCATACTGATACAGCATCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028003
VALIDATED
RPAP3 MISSION shRNA shRNA Plasmid DNA
RNA polymerase II associated protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028003.2-243s21c1
Sequence:CCGGATTTACCTCCTATTCGAAATGCTCGAGCATTTCGAATAGGAGGTAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028003.2-1834s21c1
Sequence:CCGGTCCAGATGTATTCAATCAAATCTCGAGATTTGATTGAATACATCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028003.2-671s21c1
Sequence:CCGGATCGCCTTGAGCAGGACTTACCTCGAGGTAAGTCCTGCTCAAGGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028003.2-2090s21c1
Sequence:CCGGGCCGCCTCTGTGTACATTATTCTCGAGAATAATGTACACAGAGGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028003.2-1761s21c1
Sequence:CCGGCAGAGATGCTGTATCAGTATGCTCGAGCATACTGATACAGCATCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028003
VALIDATED
RPAP3 MISSION shRNA Lentiviral Transduction Particles
RNA polymerase II associated protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028003.2-243s21c1
Sequence:CCGGATTTACCTCCTATTCGAAATGCTCGAGCATTTCGAATAGGAGGTAAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000250037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028003.2-1834s21c1
Sequence:CCGGTCCAGATGTATTCAATCAAATCTCGAGATTTGATTGAATACATCTGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000250036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028003.2-671s21c1
Sequence:CCGGATCGCCTTGAGCAGGACTTACCTCGAGGTAAGTCCTGCTCAAGGCGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000250035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028003.2-2090s21c1
Sequence:CCGGGCCGCCTCTGTGTACATTATTCTCGAGAATAATGTACACAGAGGCGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000250038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028003.2-1761s21c1
Sequence:CCGGCAGAGATGCTGTATCAGTATGCTCGAGCATACTGATACAGCATCTCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???