EMAIL THIS PAGE TO A FRIEND

RPE

ribulose-5-phosphate-3-epimerase

80 Gene Product Result for
Synonyms: RPE2-1
Gene ID:
Mouse(66646) ribulose-5-phosphate-3-epimerase
Rat(501157) ribulose-5-phosphate-3-epimerase
Thale Cress(836262) D-ribulose-5-phosphate-3-epimerase
dog(478893) ribulose-5-phosphate-3-epimerase
domestic cat(101095761) ribulose-5-phosphate-3-epimerase
Zebrafish(334897) ribulose-5-phosphate-3-epimerase
chicken(770045) ribulose-5-phosphate-3-epimerase
naked mole-rat(101698495) ribulose-5-phosphate-3-epimerase
domestic guinea pig(100730209) ribulose-5-phosphate-3-epimerase
cow(533764) ribulose-5-phosphate-3-epimerase
sheep(101123013) ribulose-5-phosphate-3-epimerase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025683 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025683 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025683 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006916 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006916 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006916 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006916 Rosetta Predictions human pricing
NM_199229 Rosetta Predictions human pricing
NM_001033903 Rosetta Predictions rat pricing
NM_025683 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107650 predicted 753
2 SASI_Hs01_00107651 predicted 775
3 SASI_Hs01_00107652 predicted 566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078228 predicted 750
2 SASI_Hs01_00078229 predicted 769
3 SASI_Hs01_00078230 predicted 568
4 SASI_Hs01_00078231 predicted 112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033903 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086525 predicted 364
2 SASI_Rn01_00086526 predicted 562
3 SASI_Rn02_00203819 predicted 574
4 SASI_Rn02_00203820 predicted 276
5 SASI_Rn01_00086527 predicted 431
6 SASI_Rn01_00086530 predicted 216
7 SASI_Rn01_00086531 predicted 663
8 SASI_Rn01_00086532 predicted 539
9 SASI_Rn01_00086533 predicted 215
10 SASI_Rn02_00203821 predicted 408
11 SASI_Rn01_00086528 predicted 741
12 SASI_Rn01_00086529 predicted 737
13 SASI_Rn01_00086534 predicted 807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025683 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067064 predicted 818
2 SASI_Mm01_00067065 predicted 222
3 SASI_Mm01_00067066 predicted 372
4 SASI_Mm01_00067067 predicted 438
5 SASI_Mm01_00067068 predicted 784
6 SASI_Mm01_00067069 predicted 847
7 SASI_Mm01_00067071 predicted 364
8 SASI_Mm01_00067072 predicted 630
9 SASI_Mm01_00067073 predicted 416
10 SASI_Mm02_00328829 predicted 957
11 SASI_Mm01_00067070 predicted 827
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025683
VALIDATED
RPE MISSION shRNA Bacterial Glycerol Stock
ribulose-5-phosphate-3-epimerase
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025683.2-1275s21c1
Sequence:CCGGGCACAGACTTATCAAGGTATTCTCGAGAATACCTTGATAAGTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025683.1-676s1c2
Sequence:CCGGGCTCAGAAACGTTCCCTTGATCTCGAGATCAAGGGAACGTTTCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025683.1-277s1c1
Sequence:CCGGGCCAATCAATATACCTTTCATCTCGAGATGAAAGGTATATTGATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025683.1-404s1c1
Sequence:CCGGCATGGGCTAATCAAATAGATACTCGAGTATCTATTTGATTAGCCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025683.1-1276s1c1
Sequence:CCGGGCACAGACTTATCAAGGTATTCTCGAGAATACCTTGATAAGTCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186910    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025683.1-1118s1c1
Sequence:CCGGGCCTGAGAATATGAATGGAATCTCGAGATTCCATTCATATTCTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025683.1-631s1c1
Sequence:CCGGCCCAGAGCTGTTATCAACTTACTCGAGTAAGTTGATAACAGCTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025683.2-630s21c1
Sequence:CCGGCCCAGAGCTGTTATCAACTTACTCGAGTAAGTTGATAACAGCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025683.1-207s1c1
Sequence:CCGGCCCTTTCTTTGATATGCACATCTCGAGATGTGCATATCAAAGAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025683.2-509s1c1
Sequence:CCGGCCAGTTTCCAACTTTGGATATCTCGAGATATCCAAAGTTGGAAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025683.2-276s21c1
Sequence:CCGGGCCAATCAATATACCTTTCATCTCGAGATGAAAGGTATATTGATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025683.2-1117s21c1
Sequence:CCGGGCCTGAGAATATGAATGGAATCTCGAGATTCCATTCATATTCTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025683
VALIDATED
RPE MISSION shRNA shRNA Plasmid DNA
ribulose-5-phosphate-3-epimerase
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025683.2-1275s21c1
Sequence:CCGGGCACAGACTTATCAAGGTATTCTCGAGAATACCTTGATAAGTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025683.1-676s1c2
Sequence:CCGGGCTCAGAAACGTTCCCTTGATCTCGAGATCAAGGGAACGTTTCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025683.1-277s1c1
Sequence:CCGGGCCAATCAATATACCTTTCATCTCGAGATGAAAGGTATATTGATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025683.1-404s1c1
Sequence:CCGGCATGGGCTAATCAAATAGATACTCGAGTATCTATTTGATTAGCCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025683.1-1276s1c1
Sequence:CCGGGCACAGACTTATCAAGGTATTCTCGAGAATACCTTGATAAGTCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186910    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025683.1-1118s1c1
Sequence:CCGGGCCTGAGAATATGAATGGAATCTCGAGATTCCATTCATATTCTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025683.1-631s1c1
Sequence:CCGGCCCAGAGCTGTTATCAACTTACTCGAGTAAGTTGATAACAGCTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025683.2-630s21c1
Sequence:CCGGCCCAGAGCTGTTATCAACTTACTCGAGTAAGTTGATAACAGCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025683.1-207s1c1
Sequence:CCGGCCCTTTCTTTGATATGCACATCTCGAGATGTGCATATCAAAGAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025683.2-509s1c1
Sequence:CCGGCCAGTTTCCAACTTTGGATATCTCGAGATATCCAAAGTTGGAAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025683.2-276s21c1
Sequence:CCGGGCCAATCAATATACCTTTCATCTCGAGATGAAAGGTATATTGATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025683.2-1117s21c1
Sequence:CCGGGCCTGAGAATATGAATGGAATCTCGAGATTCCATTCATATTCTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025683
VALIDATED
RPE MISSION shRNA Lentiviral Transduction Particles
ribulose-5-phosphate-3-epimerase
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025683.2-1275s21c1
Sequence:CCGGGCACAGACTTATCAAGGTATTCTCGAGAATACCTTGATAAGTCTGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025683.1-676s1c2
Sequence:CCGGGCTCAGAAACGTTCCCTTGATCTCGAGATCAAGGGAACGTTTCTGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025683.1-277s1c1
Sequence:CCGGGCCAATCAATATACCTTTCATCTCGAGATGAAAGGTATATTGATTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025683.1-404s1c1
Sequence:CCGGCATGGGCTAATCAAATAGATACTCGAGTATCTATTTGATTAGCCCATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025683.1-1276s1c1
Sequence:CCGGGCACAGACTTATCAAGGTATTCTCGAGAATACCTTGATAAGTCTGTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186910    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025683.1-1118s1c1
Sequence:CCGGGCCTGAGAATATGAATGGAATCTCGAGATTCCATTCATATTCTCAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025683.1-631s1c1
Sequence:CCGGCCCAGAGCTGTTATCAACTTACTCGAGTAAGTTGATAACAGCTCTGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025683.2-630s21c1
Sequence:CCGGCCCAGAGCTGTTATCAACTTACTCGAGTAAGTTGATAACAGCTCTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025683.1-207s1c1
Sequence:CCGGCCCTTTCTTTGATATGCACATCTCGAGATGTGCATATCAAAGAAAGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025683.2-509s1c1
Sequence:CCGGCCAGTTTCCAACTTTGGATATCTCGAGATATCCAAAGTTGGAAACTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025683.2-276s21c1
Sequence:CCGGGCCAATCAATATACCTTTCATCTCGAGATGAAAGGTATATTGATTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025683.2-1117s21c1
Sequence:CCGGGCCTGAGAATATGAATGGAATCTCGAGATTCCATTCATATTCTCAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006916
VALIDATED
RPE MISSION shRNA Bacterial Glycerol Stock
ribulose-5-phosphate-3-epimerase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006916.1-216s21c1
Sequence:CCGGGCCAATCAGTACACCTTTCATCTCGAGATGAAAGGTGTACTGATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006916.1-455s1c1
Sequence:CCGGGCAGAAATTCATGGAAGATATCTCGAGATATCTTCCATGAATTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_006916.1-216s1c1
Sequence:CCGGGCCAATCAGTACACCTTTCATCTCGAGATGAAAGGTGTACTGATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006916.1-420s1c1
Sequence:CCGGGCCTTGGTTATGACAGTGGAACTCGAGTTCCACTGTCATAACCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_006916.1-666s1c1
Sequence:CCGGGCTGCTCAGAAACGTTCTCTTCTCGAGAAGAGAACGTTTCTGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006916.1-580s1c1
Sequence:CCGGCTAACATGATTGTGTCTGGCACTCGAGTGCCAGACACAATCATGTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006916.1-420s21c1
Sequence:CCGGGCCTTGGTTATGACAGTGGAACTCGAGTTCCACTGTCATAACCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006916.1-666s21c1
Sequence:CCGGGCTGCTCAGAAACGTTCTCTTCTCGAGAAGAGAACGTTTCTGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006916.1-455s21c1
Sequence:CCGGGCAGAAATTCATGGAAGATATCTCGAGATATCTTCCATGAATTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006916
VALIDATED
RPE MISSION shRNA shRNA Plasmid DNA
ribulose-5-phosphate-3-epimerase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006916.1-216s21c1
Sequence:CCGGGCCAATCAGTACACCTTTCATCTCGAGATGAAAGGTGTACTGATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006916.1-455s1c1
Sequence:CCGGGCAGAAATTCATGGAAGATATCTCGAGATATCTTCCATGAATTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_006916.1-216s1c1
Sequence:CCGGGCCAATCAGTACACCTTTCATCTCGAGATGAAAGGTGTACTGATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006916.1-420s1c1
Sequence:CCGGGCCTTGGTTATGACAGTGGAACTCGAGTTCCACTGTCATAACCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_006916.1-666s1c1
Sequence:CCGGGCTGCTCAGAAACGTTCTCTTCTCGAGAAGAGAACGTTTCTGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006916.1-580s1c1
Sequence:CCGGCTAACATGATTGTGTCTGGCACTCGAGTGCCAGACACAATCATGTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006916.1-420s21c1
Sequence:CCGGGCCTTGGTTATGACAGTGGAACTCGAGTTCCACTGTCATAACCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006916.1-666s21c1
Sequence:CCGGGCTGCTCAGAAACGTTCTCTTCTCGAGAAGAGAACGTTTCTGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006916.1-455s21c1
Sequence:CCGGGCAGAAATTCATGGAAGATATCTCGAGATATCTTCCATGAATTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006916
VALIDATED
RPE MISSION shRNA Lentiviral Transduction Particles
ribulose-5-phosphate-3-epimerase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006916.1-216s21c1
Sequence:CCGGGCCAATCAGTACACCTTTCATCTCGAGATGAAAGGTGTACTGATTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006916.1-455s1c1
Sequence:CCGGGCAGAAATTCATGGAAGATATCTCGAGATATCTTCCATGAATTTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_006916.1-216s1c1
Sequence:CCGGGCCAATCAGTACACCTTTCATCTCGAGATGAAAGGTGTACTGATTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006916.1-420s1c1
Sequence:CCGGGCCTTGGTTATGACAGTGGAACTCGAGTTCCACTGTCATAACCAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_006916.1-666s1c1
Sequence:CCGGGCTGCTCAGAAACGTTCTCTTCTCGAGAAGAGAACGTTTCTGAGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006916.1-580s1c1
Sequence:CCGGCTAACATGATTGTGTCTGGCACTCGAGTGCCAGACACAATCATGTTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006916.1-420s21c1
Sequence:CCGGGCCTTGGTTATGACAGTGGAACTCGAGTTCCACTGTCATAACCAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006916.1-666s21c1
Sequence:CCGGGCTGCTCAGAAACGTTCTCTTCTCGAGAAGAGAACGTTTCTGAGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006916.1-455s21c1
Sequence:CCGGGCAGAAATTCATGGAAGATATCTCGAGATATCTTCCATGAATTTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)