EMAIL THIS PAGE TO A FRIEND

RPGRIP1

retinitis pigmentosa GTPase regulator interacting protein 1

63 Gene Product Result for
Synonyms: CORD13 LCA6 RGI1 RGRIP RPGRIP RPGRIP1d
Gene ID:
Human(57096) Summary: This gene encodes a photoreceptor protein that interacts with retinitis pigmentosa GTPase regulator protein and is a key component of cone and rod photoreceptor cells. Mutations in this gene lead to autosomal recessive congenital blindness. [provided by RefSeq, Oct 2008]
Mouse(77945) retinitis pigmentosa GTPase regulator interacting protein 1
Rat(305850) retinitis pigmentosa GTPase regulator interacting protein 1
dog(475400) retinitis pigmentosa GTPase regulator interacting protein 1
domestic cat(101098796) retinitis pigmentosa GTPase regulator interacting protein 1
Horse(100072725) retinitis pigmentosa GTPase regulator interacting protein 1
cow(282656) retinitis pigmentosa GTPase regulator interacting protein 1
sheep(101109708) retinitis pigmentosa GTPase regulator interacting protein 1
domestic guinea pig(100718788) retinitis pigmentosa GTPase regulator interacting protein 1
naked mole-rat(101698199) retinitis pigmentosa GTPase regulator interacting protein 1
Domestic Rabbit(100357598) retinitis pigmentosa GTPase regulator interacting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020366 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020366 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020366 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023879 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023879 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023879 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020366 Rosetta Predictions human pricing
NM_001030035 Rosetta Predictions rat pricing
XM_001074342 Rosetta Predictions rat pricing
XM_001075663 Rosetta Predictions rat pricing
NM_023879 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237706 predicted 2457
2 SASI_Hs01_00237707 predicted 2298
3 SASI_Hs01_00237708 predicted 1452
4 SASI_Hs01_00237709 predicted 2630
5 SASI_Hs01_00237710 predicted 1571
6 SASI_Hs02_00353317 predicted 3656
7 SASI_Hs02_00353318 predicted 2749
8 SASI_Hs01_00237713 predicted 3126
9 SASI_Hs01_00237714 predicted 2449
10 SASI_Hs01_00237715 predicted 1778
11 SASI_Hs01_00237711 predicted 2813
12 SASI_Hs01_00237712 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030035 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069773 predicted 282
2 SASI_Rn01_00069774 predicted 298
3 SASI_Rn01_00069775 predicted 663
4 SASI_Rn01_00069776 predicted 229
5 SASI_Rn01_00069777 predicted 544
6 SASI_Rn01_00069778 predicted 1240
7 SASI_Rn01_00069779 predicted 648
8 SASI_Rn01_00069781 predicted 324
9 SASI_Rn02_00203544 predicted 358
10 SASI_Rn01_00069782 predicted 224
11 SASI_Rn01_00069780 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074342 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00345864 predicted 2081
2 SASI_Rn02_00345865 predicted 1466
3 SASI_Rn02_00345866 predicted 205
4 SASI_Rn02_00345867 predicted 2509
5 SASI_Rn02_00345868 predicted 1242
6 SASI_Rn02_00345869 predicted 1117
7 SASI_Rn02_00345870 predicted 779
8 SASI_Rn02_00345871 predicted 1707
9 SASI_Rn02_00345872 predicted 3780
10 SASI_Rn02_00345873 predicted 3444
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075663 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350605 predicted 2077
2 SASI_Rn02_00350606 predicted 1458
3 SASI_Rn02_00350607 predicted 203
4 SASI_Rn02_00350608 predicted 2515
5 SASI_Rn02_00350609 predicted 1238
6 SASI_Rn02_00350610 predicted 1118
7 SASI_Rn02_00350611 predicted 778
8 SASI_Rn02_00350612 predicted 1708
9 SASI_Rn02_00350613 predicted 3781
10 SASI_Rn02_00350614 predicted 3453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023879 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152184 predicted 854
2 SASI_Mm01_00152185 predicted 568
3 SASI_Mm01_00152186 predicted 2326
4 SASI_Mm01_00152187 predicted 1799
5 SASI_Mm01_00152188 predicted 3626
6 SASI_Mm01_00152189 predicted 1006
7 SASI_Mm01_00152190 predicted 864
8 SASI_Mm01_00152191 predicted 2351
9 SASI_Mm01_00152192 predicted 1100
10 SASI_Mm01_00152193 predicted 2099
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020366
RPGRIP1 MISSION shRNA Bacterial Glycerol Stock
retinitis pigmentosa GTPase regulator interacting protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020366.x-3053s1c1
Sequence:CCGGGAATGGAGTATCTTAGCCTTACTCGAGTAAGGCTAAGATACTCCATTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020366.x-565s1c1
Sequence:CCGGGTAGCCAGTAAACCCAGTGAACTCGAGTTCACTGGGTTTACTGGCTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020366.3-2394s21c1
Sequence:CCGGGAACGAGCTGTGGATTGAAATCTCGAGATTTCAATCCACAGCTCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020366.3-820s21c1
Sequence:CCGGGTAGAGCTGATTCGACTTAAGCTCGAGCTTAAGTCGAATCAGCTCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020366.x-1639s1c1
Sequence:CCGGGCTGACAATGATAATAGAGATCTCGAGATCTCTATTATCATTGTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020366.x-3819s1c1
Sequence:CCGGCCATGCTATTTACAAGGAGATCTCGAGATCTCCTTGTAAATAGCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020366.x-1948s1c1
Sequence:CCGGCCTACCACTTTCTGCACCTATCTCGAGATAGGTGCAGAAAGTGGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020366.3-1835s21c1
Sequence:CCGGATGAGGATAAAGTGGATATTTCTCGAGAAATATCCACTTTATCCTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020366.3-529s21c1
Sequence:CCGGTTTAAGGAGCATGCGACAAATCTCGAGATTTGTCGCATGCTCCTTAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020366
RPGRIP1 MISSION shRNA shRNA Plasmid DNA
retinitis pigmentosa GTPase regulator interacting protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020366.x-3053s1c1
Sequence:CCGGGAATGGAGTATCTTAGCCTTACTCGAGTAAGGCTAAGATACTCCATTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020366.x-565s1c1
Sequence:CCGGGTAGCCAGTAAACCCAGTGAACTCGAGTTCACTGGGTTTACTGGCTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020366.3-2394s21c1
Sequence:CCGGGAACGAGCTGTGGATTGAAATCTCGAGATTTCAATCCACAGCTCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020366.3-820s21c1
Sequence:CCGGGTAGAGCTGATTCGACTTAAGCTCGAGCTTAAGTCGAATCAGCTCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020366.x-1639s1c1
Sequence:CCGGGCTGACAATGATAATAGAGATCTCGAGATCTCTATTATCATTGTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020366.x-3819s1c1
Sequence:CCGGCCATGCTATTTACAAGGAGATCTCGAGATCTCCTTGTAAATAGCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020366.x-1948s1c1
Sequence:CCGGCCTACCACTTTCTGCACCTATCTCGAGATAGGTGCAGAAAGTGGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020366.3-1835s21c1
Sequence:CCGGATGAGGATAAAGTGGATATTTCTCGAGAAATATCCACTTTATCCTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020366.3-529s21c1
Sequence:CCGGTTTAAGGAGCATGCGACAAATCTCGAGATTTGTCGCATGCTCCTTAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020366
RPGRIP1 MISSION shRNA Lentiviral Transduction Particles
retinitis pigmentosa GTPase regulator interacting protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020366.x-3053s1c1
Sequence:CCGGGAATGGAGTATCTTAGCCTTACTCGAGTAAGGCTAAGATACTCCATTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020366.x-565s1c1
Sequence:CCGGGTAGCCAGTAAACCCAGTGAACTCGAGTTCACTGGGTTTACTGGCTACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020366.3-2394s21c1
Sequence:CCGGGAACGAGCTGTGGATTGAAATCTCGAGATTTCAATCCACAGCTCGTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020366.3-820s21c1
Sequence:CCGGGTAGAGCTGATTCGACTTAAGCTCGAGCTTAAGTCGAATCAGCTCTACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020366.x-1639s1c1
Sequence:CCGGGCTGACAATGATAATAGAGATCTCGAGATCTCTATTATCATTGTCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020366.x-3819s1c1
Sequence:CCGGCCATGCTATTTACAAGGAGATCTCGAGATCTCCTTGTAAATAGCATGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020366.x-1948s1c1
Sequence:CCGGCCTACCACTTTCTGCACCTATCTCGAGATAGGTGCAGAAAGTGGTAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020366.3-1835s21c1
Sequence:CCGGATGAGGATAAAGTGGATATTTCTCGAGAAATATCCACTTTATCCTCATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020366.3-529s21c1
Sequence:CCGGTTTAAGGAGCATGCGACAAATCTCGAGATTTGTCGCATGCTCCTTAAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023879
RPGRIP1 MISSION shRNA Bacterial Glycerol Stock
retinitis pigmentosa GTPase regulator interacting protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023879.1-3198s1c1
Sequence:CCGGCGCAAGCTACTCACGAAGAAACTCGAGTTTCTTCGTGAGTAGCTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023879.1-2492s1c1
Sequence:CCGGCCAGCAGCAATCCATACTTTACTCGAGTAAAGTATGGATTGCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023879.1-1261s1c1
Sequence:CCGGGCAACCAACAAAGCAGCTCAACTCGAGTTGAGCTGCTTTGTTGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023879.1-4595s1c1
Sequence:CCGGGCTTCTCTTCTTGTCAAGATACTCGAGTATCTTGACAAGAAGAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023879.1-3633s1c1
Sequence:CCGGGCAGGTATATGTGGAGTACAACTCGAGTTGTACTCCACATATACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023879
RPGRIP1 MISSION shRNA shRNA Plasmid DNA
retinitis pigmentosa GTPase regulator interacting protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023879.1-3198s1c1
Sequence:CCGGCGCAAGCTACTCACGAAGAAACTCGAGTTTCTTCGTGAGTAGCTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023879.1-2492s1c1
Sequence:CCGGCCAGCAGCAATCCATACTTTACTCGAGTAAAGTATGGATTGCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023879.1-1261s1c1
Sequence:CCGGGCAACCAACAAAGCAGCTCAACTCGAGTTGAGCTGCTTTGTTGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023879.1-4595s1c1
Sequence:CCGGGCTTCTCTTCTTGTCAAGATACTCGAGTATCTTGACAAGAAGAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023879.1-3633s1c1
Sequence:CCGGGCAGGTATATGTGGAGTACAACTCGAGTTGTACTCCACATATACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023879
RPGRIP1 MISSION shRNA Lentiviral Transduction Particles
retinitis pigmentosa GTPase regulator interacting protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023879.1-3198s1c1
Sequence:CCGGCGCAAGCTACTCACGAAGAAACTCGAGTTTCTTCGTGAGTAGCTTGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023879.1-2492s1c1
Sequence:CCGGCCAGCAGCAATCCATACTTTACTCGAGTAAAGTATGGATTGCTGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023879.1-1261s1c1
Sequence:CCGGGCAACCAACAAAGCAGCTCAACTCGAGTTGAGCTGCTTTGTTGGTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023879.1-4595s1c1
Sequence:CCGGGCTTCTCTTCTTGTCAAGATACTCGAGTATCTTGACAAGAAGAGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023879.1-3633s1c1
Sequence:CCGGGCAGGTATATGTGGAGTACAACTCGAGTTGTACTCCACATATACCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)