EMAIL THIS PAGE TO A FRIEND

RPGRIP1L

RPGRIP1-like

191 Gene Product Result for
Synonyms: CORS3 FTM JBTS7 MKS5 NPHP8
UniProtKB ID: Q68CZ1, A0PJ88, Q9Y2K8
Gene ID:
Human(23322) Summary: The protein encoded by this gene can localize to the basal body-centrosome complex or to primary cilia and centrosomes in ciliated cells. The encoded protein has been found to interact with nephrocystin-4. Defects in this gene are a cause of Joubert syndrome type 7 (JBTS7) and Meckel syndrome type 5 (MKS5). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(244585) Rpgrip1-like
Rat(307724) Rpgrip1-like
cow(518659) RPGRIP1-like
sheep(101115055) RPGRIP1-like
Zebrafish(557688) RPGRIP1-like
chicken(425392) RPGRIP1-like
Horse(100050527) RPGRIP1-like
dog(487278) RPGRIP1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173431 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173431 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173431 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001127897 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001127897 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001127897 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_051197 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_051197 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_051197 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007921 MISSION® esiRNA esiRNA targeting human RPGRIP1L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127897 Rosetta Predictions human pricing
NM_015272 Rosetta Predictions human pricing
NM_001107414 Rosetta Predictions rat pricing
NM_173431 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127897 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330454 predicted 2250
2 SASI_Hs02_00330455 predicted 3515
3 SASI_Hs02_00330456 predicted 3839
4 SASI_Hs02_00330457 predicted 1956
5 SASI_Hs02_00330458 predicted 2543
6 SASI_Hs02_00330459 predicted 2569
7 SASI_Hs02_00330460 predicted 3419
8 SASI_Hs02_00330461 predicted 2358
9 SASI_Hs02_00330462 predicted 1726
10 SASI_Hs02_00330463 predicted 1854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153455 predicted 2249
2 SASI_Hs01_00153456 predicted 3755
3 SASI_Hs01_00153458 predicted 4077
4 SASI_Hs01_00153460 predicted 1953
5 SASI_Hs01_00153462 predicted 2539
6 SASI_Hs01_00153463 predicted 2565
7 SASI_Hs02_00347430 predicted 2364
8 SASI_Hs02_00347431 predicted 498
9 SASI_Hs02_00347432 predicted 1728
10 SASI_Hs01_00153464 predicted 1852
11 SASI_Hs01_00153457 predicted 2123
12 SASI_Hs01_00153459 predicted 1697
13 SASI_Hs01_00153461 predicted 2669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107414 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228585 predicted 2502
2 SASI_Rn02_00228586 predicted 2282
3 SASI_Rn02_00228587 predicted 993
4 SASI_Rn02_00228588 predicted 2548
5 SASI_Rn02_00228589 predicted 3440
6 SASI_Rn02_00228590 predicted 299
7 SASI_Rn02_00228591 predicted 327
8 SASI_Rn02_00228592 predicted 2384
9 SASI_Rn02_00228593 predicted 831
10 SASI_Rn02_00228594 predicted 2944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173431 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114361 predicted 2698
2 SASI_Mm01_00114362 predicted 2243
3 SASI_Mm01_00114365 predicted 257
4 SASI_Mm01_00114366 predicted 813
5 SASI_Mm01_00114367 predicted 2529
6 SASI_Mm02_00345314 predicted 2959
7 SASI_Mm01_00114369 predicted 2504
8 SASI_Mm01_00114370 predicted 2641
9 SASI_Mm02_00345315 predicted 2211
10 SASI_Mm02_00345316 predicted 3401
11 SASI_Mm01_00114363 predicted 1829
12 SASI_Mm01_00114364 predicted 2500
13 SASI_Mm01_00114368 predicted 3734
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173431
RPGRIP1L MISSION shRNA Bacterial Glycerol Stock
RPGRIP1-like
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173431.2-3361s21c1
Sequence:CCGGATAACCAGGGAGGATACTATTCTCGAGAATAGTATCCTCCCTGGTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173431.2-2245s21c1
Sequence:CCGGGATCAAGCTATTCGACTTTATCTCGAGATAAAGTCGAATAGCTTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173431.1-2786s1c1
Sequence:CCGGGCAGGAACTATCCAAGTTATACTCGAGTATAACTTGGATAGTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106075    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173431.1-4284s1c1
Sequence:CCGGCGCCTCTGATTAGCCTCATTACTCGAGTAATGAGGCTAATCAGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173431.1-105s1c1
Sequence:CCGGCGGTGAAAGATACAGGTCTAACTCGAGTTAGACCTGTATCTTTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173431.1-317s1c1
Sequence:CCGGCGGCTAGTTAATGACAAGAAACTCGAGTTTCTTGTCATTAACTAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173431.1-854s1c1
Sequence:CCGGCGGGACAATGTAGAAACGATTCTCGAGAATCGTTTCTACATTGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173431
RPGRIP1L MISSION shRNA shRNA Plasmid DNA
RPGRIP1-like
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173431.2-3361s21c1
Sequence:CCGGATAACCAGGGAGGATACTATTCTCGAGAATAGTATCCTCCCTGGTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173431.2-2245s21c1
Sequence:CCGGGATCAAGCTATTCGACTTTATCTCGAGATAAAGTCGAATAGCTTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173431.1-2786s1c1
Sequence:CCGGGCAGGAACTATCCAAGTTATACTCGAGTATAACTTGGATAGTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106075    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173431.1-4284s1c1
Sequence:CCGGCGCCTCTGATTAGCCTCATTACTCGAGTAATGAGGCTAATCAGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173431.1-105s1c1
Sequence:CCGGCGGTGAAAGATACAGGTCTAACTCGAGTTAGACCTGTATCTTTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173431.1-317s1c1
Sequence:CCGGCGGCTAGTTAATGACAAGAAACTCGAGTTTCTTGTCATTAACTAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173431.1-854s1c1
Sequence:CCGGCGGGACAATGTAGAAACGATTCTCGAGAATCGTTTCTACATTGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173431
RPGRIP1L MISSION shRNA Lentiviral Transduction Particles
RPGRIP1-like
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173431.2-3361s21c1
Sequence:CCGGATAACCAGGGAGGATACTATTCTCGAGAATAGTATCCTCCCTGGTTATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173431.2-2245s21c1
Sequence:CCGGGATCAAGCTATTCGACTTTATCTCGAGATAAAGTCGAATAGCTTGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173431.1-2786s1c1
Sequence:CCGGGCAGGAACTATCCAAGTTATACTCGAGTATAACTTGGATAGTTCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106075    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173431.1-4284s1c1
Sequence:CCGGCGCCTCTGATTAGCCTCATTACTCGAGTAATGAGGCTAATCAGAGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173431.1-105s1c1
Sequence:CCGGCGGTGAAAGATACAGGTCTAACTCGAGTTAGACCTGTATCTTTCACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173431.1-317s1c1
Sequence:CCGGCGGCTAGTTAATGACAAGAAACTCGAGTTTCTTGTCATTAACTAGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173431.1-854s1c1
Sequence:CCGGCGGGACAATGTAGAAACGATTCTCGAGAATCGTTTCTACATTGTCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001127897
VALIDATED
RPGRIP1L MISSION shRNA Bacterial Glycerol Stock
RPGRIP1-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001127897.1-4038s21c1
Sequence:CCGGTAGCGTGAGAAAGTCTATTTGCTCGAGCAAATAGACTTTCTCACGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001127897.1-2011s21c1
Sequence:CCGGAGGCCTTCATCCCGAATATAACTCGAGTTATATTCGGGATGAAGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001127897.1-152s21c1
Sequence:CCGGACTTCAACAACACGGACAATGCTCGAGCATTGTCCGTGTTGTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001127897.1-3414s21c1
Sequence:CCGGAGTGGGTCTACTATAACTATACTCGAGTATAGTTATAGTAGACCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001127897.1-1443s21c1
Sequence:CCGGGTGAAGCTCTCCTACTTATAACTCGAGTTATAAGTAGGAGAGCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001127897.1-1736s21c1
Sequence:CCGGAGGGCTGCACGTATCCATAAACTCGAGTTTATGGATACGTGCAGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001127897.1-2569s21c1
Sequence:CCGGTCCACAGTTTGATGATCATATCTCGAGATATGATCATCAAACTGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001127897.1-2250s21c1
Sequence:CCGGTGGAATACTGGTTCCGATTAACTCGAGTTAATCGGAACCAGTATTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001127897.1-2282s21c1
Sequence:CCGGGATCAAGCAATTCGACTTTATCTCGAGATAAAGTCGAATTGCTTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001127897.1-4967s21c1
Sequence:CCGGACCTAATTTGCCGTGATATATCTCGAGATATATCACGGCAAATTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001127897
VALIDATED
RPGRIP1L MISSION shRNA shRNA Plasmid DNA
RPGRIP1-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001127897.1-4038s21c1
Sequence:CCGGTAGCGTGAGAAAGTCTATTTGCTCGAGCAAATAGACTTTCTCACGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001127897.1-2011s21c1
Sequence:CCGGAGGCCTTCATCCCGAATATAACTCGAGTTATATTCGGGATGAAGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001127897.1-152s21c1
Sequence:CCGGACTTCAACAACACGGACAATGCTCGAGCATTGTCCGTGTTGTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001127897.1-3414s21c1
Sequence:CCGGAGTGGGTCTACTATAACTATACTCGAGTATAGTTATAGTAGACCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001127897.1-1443s21c1
Sequence:CCGGGTGAAGCTCTCCTACTTATAACTCGAGTTATAAGTAGGAGAGCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001127897.1-1736s21c1
Sequence:CCGGAGGGCTGCACGTATCCATAAACTCGAGTTTATGGATACGTGCAGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001127897.1-2569s21c1
Sequence:CCGGTCCACAGTTTGATGATCATATCTCGAGATATGATCATCAAACTGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001127897.1-2250s21c1
Sequence:CCGGTGGAATACTGGTTCCGATTAACTCGAGTTAATCGGAACCAGTATTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001127897.1-2282s21c1
Sequence:CCGGGATCAAGCAATTCGACTTTATCTCGAGATAAAGTCGAATTGCTTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001127897.1-4967s21c1
Sequence:CCGGACCTAATTTGCCGTGATATATCTCGAGATATATCACGGCAAATTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001127897
VALIDATED
RPGRIP1L MISSION shRNA Lentiviral Transduction Particles
RPGRIP1-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001127897.1-4038s21c1
Sequence:CCGGTAGCGTGAGAAAGTCTATTTGCTCGAGCAAATAGACTTTCTCACGCTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001127897.1-2011s21c1
Sequence:CCGGAGGCCTTCATCCCGAATATAACTCGAGTTATATTCGGGATGAAGGCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001127897.1-152s21c1
Sequence:CCGGACTTCAACAACACGGACAATGCTCGAGCATTGTCCGTGTTGTTGAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001127897.1-3414s21c1
Sequence:CCGGAGTGGGTCTACTATAACTATACTCGAGTATAGTTATAGTAGACCCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001127897.1-1443s21c1
Sequence:CCGGGTGAAGCTCTCCTACTTATAACTCGAGTTATAAGTAGGAGAGCTTCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001127897.1-1736s21c1
Sequence:CCGGAGGGCTGCACGTATCCATAAACTCGAGTTTATGGATACGTGCAGCCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001127897.1-2569s21c1
Sequence:CCGGTCCACAGTTTGATGATCATATCTCGAGATATGATCATCAAACTGTGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001127897.1-2250s21c1
Sequence:CCGGTGGAATACTGGTTCCGATTAACTCGAGTTAATCGGAACCAGTATTCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001127897.1-2282s21c1
Sequence:CCGGGATCAAGCAATTCGACTTTATCTCGAGATAAAGTCGAATTGCTTGATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001127897.1-4967s21c1
Sequence:CCGGACCTAATTTGCCGTGATATATCTCGAGATATATCACGGCAAATTAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_051197
VALIDATED
RPGRIP1L MISSION shRNA Bacterial Glycerol Stock
RPGRIP1-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051197.9-3695s1c1
Sequence:CCGGGCCTAATAGAAGCCTTCGCTTCTCGAGAAGCGAAGGCTTCTATTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_051197.9-4376s1c1
Sequence:CCGGGCCTATGATTAGCTTCATTAACTCGAGTTAATGAAGCTAATCATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:XM_051197.9-180s1c1
Sequence:CCGGCCTGTGAAAGATACAGGTCTACTCGAGTAGACCTGTATCTTTCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051197.9-378s1c1
Sequence:CCGGGCCACCAAGTTAATACGGCTACTCGAGTAGCCGTATTAACTTGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:XM_051197.9-1763s1c1
Sequence:CCGGGCAGCAAGATTATGAACTCAACTCGAGTTGAGTTCATAATCTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_051197
VALIDATED
RPGRIP1L MISSION shRNA shRNA Plasmid DNA
RPGRIP1-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051197.9-3695s1c1
Sequence:CCGGGCCTAATAGAAGCCTTCGCTTCTCGAGAAGCGAAGGCTTCTATTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_051197.9-4376s1c1
Sequence:CCGGGCCTATGATTAGCTTCATTAACTCGAGTTAATGAAGCTAATCATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:XM_051197.9-180s1c1
Sequence:CCGGCCTGTGAAAGATACAGGTCTACTCGAGTAGACCTGTATCTTTCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051197.9-378s1c1
Sequence:CCGGGCCACCAAGTTAATACGGCTACTCGAGTAGCCGTATTAACTTGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:XM_051197.9-1763s1c1
Sequence:CCGGGCAGCAAGATTATGAACTCAACTCGAGTTGAGTTCATAATCTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_051197
VALIDATED
RPGRIP1L MISSION shRNA Lentiviral Transduction Particles
RPGRIP1-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051197.9-3695s1c1
Sequence:CCGGGCCTAATAGAAGCCTTCGCTTCTCGAGAAGCGAAGGCTTCTATTAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_051197.9-4376s1c1
Sequence:CCGGGCCTATGATTAGCTTCATTAACTCGAGTTAATGAAGCTAATCATAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:XM_051197.9-180s1c1
Sequence:CCGGCCTGTGAAAGATACAGGTCTACTCGAGTAGACCTGTATCTTTCACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051197.9-378s1c1
Sequence:CCGGGCCACCAAGTTAATACGGCTACTCGAGTAGCCGTATTAACTTGGTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:XM_051197.9-1763s1c1
Sequence:CCGGGCAGCAAGATTATGAACTCAACTCGAGTTGAGTTCATAATCTTGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)