EMAIL THIS PAGE TO A FRIEND

RPH3A

rabphilin 3A homolog (mouse)

39 Gene Product Result for
UniProtKB ID: Q9Y2J0, B7Z3C3, Q96AE0
Gene ID:
Human(22895) Summary: Exocytosis of neurotransmitters and hormones is fundamental to synaptic neurotransmission and cell-cell communication. RAB3A (MIM 179390) is a small G protein that is thought to act at late stages of exocytosis, and RPH3A is a RAB3A effector (Lin et al., 2007 [PubMed 17149709]
Mouse(19894) rabphilin 3A
Rat(171039) rabphilin 3A
chicken(416886) rabphilin 3A homolog (mouse)
domestic cat(101086009) rabphilin 3A homolog (mouse)
dog(611038) rabphilin 3A homolog (mouse)
cow(282044) rabphilin 3A homolog (mouse)
sheep(101113886) rabphilin 3A homolog (mouse)
domestic guinea pig(100733083) rabphilin 3A homolog (mouse)
naked mole-rat(101700256) rabphilin 3A homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011286 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011286 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011286 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014954 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014954 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014954 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069181 MISSION® esiRNA esiRNA human RPH3A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014954 Rosetta Predictions human pricing
NM_133518 Rosetta Predictions rat pricing
NM_011286 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069292 predicted 921
2 SASI_Hs01_00069293 predicted 458
3 SASI_Hs01_00069294 predicted 365
4 SASI_Hs01_00069295 predicted 2105
5 SASI_Hs01_00069297 predicted 2038
6 SASI_Hs01_00069298 predicted 1413
7 SASI_Hs01_00069299 predicted 2093
8 SASI_Hs01_00069300 predicted 2084
9 SASI_Hs02_00346633 predicted 1120
10 SASI_Hs01_00069301 predicted 222
11 SASI_Hs01_00069296 predicted 1468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133518 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054461 predicted 433
2 SASI_Rn01_00054462 predicted 1898
3 SASI_Rn01_00054463 predicted 2282
4 SASI_Rn01_00054464 predicted 1571
5 SASI_Rn02_00267698 predicted 1409
6 SASI_Rn01_00054465 predicted 2096
7 SASI_Rn01_00054467 predicted 2269
8 SASI_Rn01_00054468 predicted 676
9 SASI_Rn01_00054469 predicted 2239
10 SASI_Rn01_00054470 predicted 1398
11 SASI_Rn01_00054466 predicted 1087
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011286 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048723 predicted 580
2 SASI_Mm01_00048724 predicted 2221
3 SASI_Mm01_00048725 predicted 1507
4 SASI_Mm01_00048726 predicted 2358
5 SASI_Mm01_00048727 predicted 1520
6 SASI_Mm01_00048728 predicted 2373
7 SASI_Mm01_00048729 predicted 656
8 SASI_Mm01_00048730 predicted 1525
9 SASI_Mm01_00048731 predicted 2222
10 SASI_Mm01_00048732 predicted 1196
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011286
RPH3A MISSION shRNA Bacterial Glycerol Stock
rabphilin 3A homolog (mouse)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011286.2-2305s1c1
Sequence:CCGGCATTGGCAAGTCTAATGATTACTCGAGTAATCATTAGACTTGCCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011286.2-2386s1c1
Sequence:CCGGGTGTTTGAAGAACAAAGACAACTCGAGTTGTCTTTGTTCTTCAAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011286.2-3521s1c1
Sequence:CCGGCCATGACAAATCCAGAGGAATCTCGAGATTCCTCTGGATTTGTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011286.2-569s1c1
Sequence:CCGGGAGATCATCAACAGAGTGATTCTCGAGAATCACTCTGTTGATGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011286.2-2303s1c1
Sequence:CCGGGACATTGGCAAGTCTAATGATCTCGAGATCATTAGACTTGCCAATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011286
RPH3A MISSION shRNA shRNA Plasmid DNA
rabphilin 3A homolog (mouse)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011286.2-2305s1c1
Sequence:CCGGCATTGGCAAGTCTAATGATTACTCGAGTAATCATTAGACTTGCCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011286.2-2386s1c1
Sequence:CCGGGTGTTTGAAGAACAAAGACAACTCGAGTTGTCTTTGTTCTTCAAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011286.2-3521s1c1
Sequence:CCGGCCATGACAAATCCAGAGGAATCTCGAGATTCCTCTGGATTTGTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011286.2-569s1c1
Sequence:CCGGGAGATCATCAACAGAGTGATTCTCGAGAATCACTCTGTTGATGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011286.2-2303s1c1
Sequence:CCGGGACATTGGCAAGTCTAATGATCTCGAGATCATTAGACTTGCCAATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011286
RPH3A MISSION shRNA Lentiviral Transduction Particles
rabphilin 3A homolog (mouse)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011286.2-2305s1c1
Sequence:CCGGCATTGGCAAGTCTAATGATTACTCGAGTAATCATTAGACTTGCCAATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011286.2-2386s1c1
Sequence:CCGGGTGTTTGAAGAACAAAGACAACTCGAGTTGTCTTTGTTCTTCAAACACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011286.2-3521s1c1
Sequence:CCGGCCATGACAAATCCAGAGGAATCTCGAGATTCCTCTGGATTTGTCATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011286.2-569s1c1
Sequence:CCGGGAGATCATCAACAGAGTGATTCTCGAGAATCACTCTGTTGATGATCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011286.2-2303s1c1
Sequence:CCGGGACATTGGCAAGTCTAATGATCTCGAGATCATTAGACTTGCCAATGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014954
RPH3A MISSION shRNA Bacterial Glycerol Stock
rabphilin 3A homolog (mouse)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014954.1-827s1c1
Sequence:CCGGCCCACAGCCTATGCCTATAAACTCGAGTTTATAGGCATAGGCTGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014954.3-1620s21c1
Sequence:CCGGCCTGCAGTGCACCATCATTAACTCGAGTTAATGATGGTGCACTGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014954.3-1946s21c1
Sequence:CCGGAGCGAGTGATTCCTATGAAACCTCGAGGTTTCATAGGAATCACTCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014954.1-2698s1c1
Sequence:CCGGCCTCTCAGTTTGGGTAAATTACTCGAGTAATTTACCCAAACTGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014954.1-664s1c1
Sequence:CCGGGTGTAGTATGTGAGGACTGTACTCGAGTACAGTCCTCACATACTACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014954.1-2172s1c1
Sequence:CCGGCCCGAATTCAATGAGGAGTTTCTCGAGAAACTCCTCATTGAATTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014954.3-2460s21c1
Sequence:CCGGGAACCACGTGTCAAGTGATTACTCGAGTAATCACTTGACACGTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014954.3-1858s21c1
Sequence:CCGGTTTGGCCACAATGAATTTATTCTCGAGAATAAATTCATTGTGGCCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014954.3-2325s21c1
Sequence:CCGGCATCGGCAAGTCCAATGATTACTCGAGTAATCATTGGACTTGCCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014954
RPH3A MISSION shRNA shRNA Plasmid DNA
rabphilin 3A homolog (mouse)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014954.1-827s1c1
Sequence:CCGGCCCACAGCCTATGCCTATAAACTCGAGTTTATAGGCATAGGCTGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014954.3-1620s21c1
Sequence:CCGGCCTGCAGTGCACCATCATTAACTCGAGTTAATGATGGTGCACTGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014954.3-1946s21c1
Sequence:CCGGAGCGAGTGATTCCTATGAAACCTCGAGGTTTCATAGGAATCACTCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014954.1-2698s1c1
Sequence:CCGGCCTCTCAGTTTGGGTAAATTACTCGAGTAATTTACCCAAACTGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014954.1-664s1c1
Sequence:CCGGGTGTAGTATGTGAGGACTGTACTCGAGTACAGTCCTCACATACTACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014954.1-2172s1c1
Sequence:CCGGCCCGAATTCAATGAGGAGTTTCTCGAGAAACTCCTCATTGAATTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014954.3-2460s21c1
Sequence:CCGGGAACCACGTGTCAAGTGATTACTCGAGTAATCACTTGACACGTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014954.3-1858s21c1
Sequence:CCGGTTTGGCCACAATGAATTTATTCTCGAGAATAAATTCATTGTGGCCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014954.3-2325s21c1
Sequence:CCGGCATCGGCAAGTCCAATGATTACTCGAGTAATCATTGGACTTGCCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014954
RPH3A MISSION shRNA Lentiviral Transduction Particles
rabphilin 3A homolog (mouse)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014954.1-827s1c1
Sequence:CCGGCCCACAGCCTATGCCTATAAACTCGAGTTTATAGGCATAGGCTGTGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014954.3-1620s21c1
Sequence:CCGGCCTGCAGTGCACCATCATTAACTCGAGTTAATGATGGTGCACTGCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014954.3-1946s21c1
Sequence:CCGGAGCGAGTGATTCCTATGAAACCTCGAGGTTTCATAGGAATCACTCGCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014954.1-2698s1c1
Sequence:CCGGCCTCTCAGTTTGGGTAAATTACTCGAGTAATTTACCCAAACTGAGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014954.1-664s1c1
Sequence:CCGGGTGTAGTATGTGAGGACTGTACTCGAGTACAGTCCTCACATACTACACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014954.1-2172s1c1
Sequence:CCGGCCCGAATTCAATGAGGAGTTTCTCGAGAAACTCCTCATTGAATTCGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014954.3-2460s21c1
Sequence:CCGGGAACCACGTGTCAAGTGATTACTCGAGTAATCACTTGACACGTGGTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014954.3-1858s21c1
Sequence:CCGGTTTGGCCACAATGAATTTATTCTCGAGAATAAATTCATTGTGGCCAAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014954.3-2325s21c1
Sequence:CCGGCATCGGCAAGTCCAATGATTACTCGAGTAATCATTGGACTTGCCGATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)