EMAIL THIS PAGE TO A FRIEND

RPL10

ribosomal protein L10

131 Gene Product Result for
Synonyms: AUTSX5 DXS648 DXS648E L10 NOV QM
Gene ID:
Human(6134) Summary: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of four RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L10E family of ribosomal proteins. It is located in the cytoplasm. In vitro studies have shown that the chicken protein can bind to c-Jun and can repress c-Jun-mediated transcriptional activation, but these activities have not been demonstrated in vivo. This gene was initially identified as a candidate for a Wilms tumor suppressor gene, but later studies determined that this gene is not involved in the suppression of Wilms tumor. This gene has been referred to as 'laminin receptor homolog' because a chimeric transcript consisting of sequence from this gene and sequence from the laminin receptor gene was isolated; however, it is not believed that this gene encodes a laminin receptor. Alternative splicing results in multiple transcript variants. This gene also uses multiple polyA signals, with the 3'-most polyA signal overlapping the deoxyribonuclease I-like 1 gene on the opposite strand. This gene is co-transcribed with the small nucleolar RNA gene U70, which is located in its fifth intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Feb 2012]
Mouse(110954) ribosomal protein L10
Rat(81764) ribosomal protein L10
fruit fly(43864) Ribosomal protein L10
Zebrafish(336712) ribosomal protein L10
dog(481085) ribosomal protein L10
domestic cat(101083663) ribosomal protein L10
naked mole-rat(101702793) ribosomal protein L10
Domestic Rabbit(100328757) ribosomal protein L10
domestic guinea pig(100724614) ribosomal protein L10
cow(286790) ribosomal protein L10
sheep(100127215) ribosomal protein L10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052835 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_052835 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_052835 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006013 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006013 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006013 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041111 MISSION® esiRNA esiRNA human RPL10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006013 Rosetta Predictions human pricing
NM_031100 Rosetta Predictions rat pricing
XM_212832 Rosetta Predictions rat pricing
NM_052835 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006013 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210209 predicted 1019
2 SASI_Hs01_00210210 predicted 1092
3 SASI_Hs01_00210211 predicted 881
4 SASI_Hs01_00210212 predicted 1019
5 SASI_Hs02_00340721 predicted 1148
6 SASI_Hs01_00210214 predicted 794
7 SASI_Hs01_00210215 predicted 767
8 SASI_Hs01_00210216 predicted 274
9 SASI_Hs02_00340722 predicted 1084
10 SASI_Hs02_00340723 predicted 742
11 SASI_Hs01_00210213 predicted 251
12 SASI_Hs01_00210217 predicted 260
13 SASI_Hs01_00210218 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031100 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052154 predicted 243
2 SASI_Rn02_00264360 predicted 269
3 SASI_Rn02_00264361 predicted 335
4 SASI_Rn01_00052156 predicted 457
5 SASI_Rn01_00052157 predicted 299
6 SASI_Rn01_00052159 predicted 255
7 SASI_Rn02_00264362 predicted 469
8 SASI_Rn01_00052160 predicted 471
9 SASI_Rn01_00052163 predicted 255
10 SASI_Rn02_00264363 predicted 263
11 SASI_Rn01_00052155 predicted 209
12 SASI_Rn01_00052158 predicted 213
13 SASI_Rn01_00052161 predicted 492
14 SASI_Rn01_00052162 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_212832 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00139132 predicted 452
2 SASI_Rn01_00139133 predicted 296
3 SASI_Rn01_00139134 predicted 468
4 SASI_Rn01_00139135 predicted 481
5 SASI_Rn01_00139136 predicted 221
6 SASI_Rn01_00139137 predicted 331
7 SASI_Rn01_00139138 predicted 336
8 SASI_Rn01_00139139 predicted 494
9 SASI_Rn01_00139140 predicted 488
10 SASI_Rn01_00139141 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052835 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337494 predicted 432
2 SASI_Mm01_00143350 predicted 450
3 SASI_Mm01_00143351 predicted 451
4 SASI_Mm01_00143352 predicted 680
5 SASI_Mm01_00143353 predicted 682
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052835
RPL10 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L10
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052835.3-569s21c1
Sequence:CCGGCAGAAGATCCACATCTCAAAGCTCGAGCTTTGAGATGTGGATCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052835.3-234s21c1
Sequence:CCGGATATGGTGTCAGATGAATATGCTCGAGCATATTCATCTGACACCATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052835.1-245s1c1
Sequence:CCGGCCCGTATTTGTGCCAACAAATCTCGAGATTTGTTGGCACAAATACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052835.1-563s1c1
Sequence:CCGGCCAAGTTTAATGCAGATGAATCTCGAGATTCATCTGCATTAAACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052835.1-120s1c1
Sequence:CCGGCCCTGATGCTAAGATCCGAATCTCGAGATTCGGATCTTAGCATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052835.1-87s1c1
Sequence:CCGGGCCATACCCAAAGTCTCGTTTCTCGAGAAACGAGACTTTGGGTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052835.1-456s1c1
Sequence:CCGGCCGAACCAAGTTGCAGAACAACTCGAGTTGTTCTGCAACTTGGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052835.3-659s21c1
Sequence:CCGGGATGGCTGTGGTGTCAAATATCTCGAGATATTTGACACCACAGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052835
RPL10 MISSION shRNA shRNA Plasmid DNA
ribosomal protein L10
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052835.3-569s21c1
Sequence:CCGGCAGAAGATCCACATCTCAAAGCTCGAGCTTTGAGATGTGGATCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052835.3-234s21c1
Sequence:CCGGATATGGTGTCAGATGAATATGCTCGAGCATATTCATCTGACACCATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052835.1-245s1c1
Sequence:CCGGCCCGTATTTGTGCCAACAAATCTCGAGATTTGTTGGCACAAATACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052835.1-563s1c1
Sequence:CCGGCCAAGTTTAATGCAGATGAATCTCGAGATTCATCTGCATTAAACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052835.1-120s1c1
Sequence:CCGGCCCTGATGCTAAGATCCGAATCTCGAGATTCGGATCTTAGCATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052835.1-87s1c1
Sequence:CCGGGCCATACCCAAAGTCTCGTTTCTCGAGAAACGAGACTTTGGGTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052835.1-456s1c1
Sequence:CCGGCCGAACCAAGTTGCAGAACAACTCGAGTTGTTCTGCAACTTGGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052835.3-659s21c1
Sequence:CCGGGATGGCTGTGGTGTCAAATATCTCGAGATATTTGACACCACAGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052835
RPL10 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L10
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052835.3-569s21c1
Sequence:CCGGCAGAAGATCCACATCTCAAAGCTCGAGCTTTGAGATGTGGATCTTCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052835.3-234s21c1
Sequence:CCGGATATGGTGTCAGATGAATATGCTCGAGCATATTCATCTGACACCATATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052835.1-245s1c1
Sequence:CCGGCCCGTATTTGTGCCAACAAATCTCGAGATTTGTTGGCACAAATACGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052835.1-563s1c1
Sequence:CCGGCCAAGTTTAATGCAGATGAATCTCGAGATTCATCTGCATTAAACTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052835.1-120s1c1
Sequence:CCGGCCCTGATGCTAAGATCCGAATCTCGAGATTCGGATCTTAGCATCAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052835.1-87s1c1
Sequence:CCGGGCCATACCCAAAGTCTCGTTTCTCGAGAAACGAGACTTTGGGTATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052835.1-456s1c1
Sequence:CCGGCCGAACCAAGTTGCAGAACAACTCGAGTTGTTCTGCAACTTGGTTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052835.3-659s21c1
Sequence:CCGGGATGGCTGTGGTGTCAAATATCTCGAGATATTTGACACCACAGCCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006013
VALIDATED
RPL10 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006013.3-389s21c1
Sequence:CCGGTGCCCGAATTTGTGCCAATAACTCGAGTTATTGGCACAAATTCGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006013.3-709s21c1
Sequence:CCGGCCAAGTTCAATGCTGATGAATCTCGAGATTCATCAGCATTGAACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006013.3-267s21c1
Sequence:CCGGCCTGATGCCAAGATTCGCATTCTCGAGAATGCGAATCTTGGCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006013.2-242s1c1
Sequence:CCGGTGCCCGAATTTGTGCCAATAACTCGAGTTATTGGCACAAATTCGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006013.3-854s21c1
Sequence:CCGGCCCTCTTAATACTCACCAATACTCGAGTATTGGTGAGTATTAAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006013.2-707s1c1
Sequence:CCGGCCCTCTTAATACTCACCAATACTCGAGTATTGGTGAGTATTAAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006013.2-120s1c1
Sequence:CCGGCCTGATGCCAAGATTCGCATTCTCGAGAATGCGAATCTTGGCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006013.2-245s1c1
Sequence:CCGGCCGAATTTGTGCCAATAAGTACTCGAGTACTTATTGGCACAAATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006013.2-562s1c1
Sequence:CCGGCCAAGTTCAATGCTGATGAATCTCGAGATTCATCAGCATTGAACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006013
VALIDATED
RPL10 MISSION shRNA shRNA Plasmid DNA
ribosomal protein L10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006013.3-389s21c1
Sequence:CCGGTGCCCGAATTTGTGCCAATAACTCGAGTTATTGGCACAAATTCGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006013.3-709s21c1
Sequence:CCGGCCAAGTTCAATGCTGATGAATCTCGAGATTCATCAGCATTGAACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006013.3-267s21c1
Sequence:CCGGCCTGATGCCAAGATTCGCATTCTCGAGAATGCGAATCTTGGCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006013.2-242s1c1
Sequence:CCGGTGCCCGAATTTGTGCCAATAACTCGAGTTATTGGCACAAATTCGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006013.3-854s21c1
Sequence:CCGGCCCTCTTAATACTCACCAATACTCGAGTATTGGTGAGTATTAAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006013.2-707s1c1
Sequence:CCGGCCCTCTTAATACTCACCAATACTCGAGTATTGGTGAGTATTAAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006013.2-120s1c1
Sequence:CCGGCCTGATGCCAAGATTCGCATTCTCGAGAATGCGAATCTTGGCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006013.2-245s1c1
Sequence:CCGGCCGAATTTGTGCCAATAAGTACTCGAGTACTTATTGGCACAAATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006013.2-562s1c1
Sequence:CCGGCCAAGTTCAATGCTGATGAATCTCGAGATTCATCAGCATTGAACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006013
VALIDATED
RPL10 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006013.3-389s21c1
Sequence:CCGGTGCCCGAATTTGTGCCAATAACTCGAGTTATTGGCACAAATTCGGGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006013.3-709s21c1
Sequence:CCGGCCAAGTTCAATGCTGATGAATCTCGAGATTCATCAGCATTGAACTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006013.3-267s21c1
Sequence:CCGGCCTGATGCCAAGATTCGCATTCTCGAGAATGCGAATCTTGGCATCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006013.2-242s1c1
Sequence:CCGGTGCCCGAATTTGTGCCAATAACTCGAGTTATTGGCACAAATTCGGGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006013.3-854s21c1
Sequence:CCGGCCCTCTTAATACTCACCAATACTCGAGTATTGGTGAGTATTAAGAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006013.2-707s1c1
Sequence:CCGGCCCTCTTAATACTCACCAATACTCGAGTATTGGTGAGTATTAAGAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006013.2-120s1c1
Sequence:CCGGCCTGATGCCAAGATTCGCATTCTCGAGAATGCGAATCTTGGCATCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006013.2-245s1c1
Sequence:CCGGCCGAATTTGTGCCAATAAGTACTCGAGTACTTATTGGCACAAATTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006013.2-562s1c1
Sequence:CCGGCCAAGTTCAATGCTGATGAATCTCGAGATTCATCAGCATTGAACTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)