EMAIL THIS PAGE TO A FRIEND

RPL10L

ribosomal protein L10-like

64 Gene Product Result for
Synonyms: RPL10_5_1358
UniProtKB ID: Q96L21, Q8IUD1
Gene ID:
Human(140801) Summary: This gene encodes a protein sharing sequence similarity with ribosomal protein L10. It is not currently known whether the encoded protein is a functional ribosomal protein or whether it has evolved a function that is independent of the ribosome. This gene is intronless. [provided by RefSeq, Jul 2008]
Mouse(238217) ribosomal protein L10-like
Rat(299106) ribosomal protein L10-like
chicken(396411) ribosomal protein L10-like
domestic cat(101089777) ribosomal protein L10-like
dog(490672) ribosomal protein L10-like
cow(538748) ribosomal protein L10-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080746 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080746 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080746 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001162933 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001162933 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001162933 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080746 Rosetta Predictions human pricing
XM_001080201 Rosetta Predictions rat pricing
XM_234245 Rosetta Predictions rat pricing
XM_138143 Rosetta Predictions mouse pricing
XM_916339 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080746 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169624 predicted 567
2 SASI_Hs01_00169627 predicted 525
3 SASI_Hs01_00169629 predicted 330
4 SASI_Hs01_00169630 predicted 467
5 SASI_Hs01_00169631 predicted 511
6 SASI_Hs02_00362544 predicted 323
7 SASI_Hs02_00362545 predicted 498
8 SASI_Hs01_00169623 predicted 290
9 SASI_Hs01_00169625 predicted 286
10 SASI_Hs01_00169626 predicted 294
11 SASI_Hs01_00169628 predicted 297
12 SASI_Hs01_00169632 predicted 561
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080201 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367028 predicted 713
2 SASI_Rn02_00367029 predicted 705
3 SASI_Rn02_00367030 predicted 484
4 SASI_Rn02_00367031 predicted 701
5 SASI_Rn02_00367032 predicted 247
6 SASI_Rn02_00367033 predicted 459
7 SASI_Rn02_00367034 predicted 237
8 SASI_Rn02_00367035 predicted 439
9 SASI_Rn02_00367036 predicted 795
10 SASI_Rn02_00367037 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234245 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388356 predicted 716
2 SASI_Rn02_00388357 predicted 711
3 SASI_Rn02_00388358 predicted 479
4 SASI_Rn02_00388359 predicted 706
5 SASI_Rn02_00388360 predicted 240
6 SASI_Rn02_00388361 predicted 457
7 SASI_Rn02_00388362 predicted 238
8 SASI_Rn02_00388363 predicted 442
9 SASI_Rn02_00388364 predicted 794
10 SASI_Rn02_00388365 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_138143 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276941 predicted 557
2 SASI_Mm01_00276942 predicted 549
3 SASI_Mm01_00276943 predicted 241
4 SASI_Mm01_00276944 predicted 559
5 SASI_Mm01_00276945 predicted 703
6 SASI_Mm01_00276947 predicted 231
7 SASI_Mm01_00276948 predicted 620
8 SASI_Mm01_00276949 predicted 782
9 SASI_Mm02_00424808 predicted 550
10 SASI_Mm02_00424809 predicted 709
11 SASI_Mm01_00276940 predicted 800
12 SASI_Mm01_00276946 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_916339 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00440257 predicted 794
2 SASI_Mm02_00440258 predicted 561
3 SASI_Mm02_00440259 predicted 550
4 SASI_Mm02_00440260 predicted 238
5 SASI_Mm02_00440261 predicted 557
6 SASI_Mm02_00440262 predicted 698
7 SASI_Mm02_00440263 predicted 230
8 SASI_Mm02_00440264 predicted 619
9 SASI_Mm02_00440265 predicted 783
10 SASI_Mm02_00440266 predicted 556
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080746
VALIDATED
RPL10L MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L10-like
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080746.2-325s21c1
Sequence:CCGGGTTGTGGCAGAGATGGCTTTCCTCGAGGAAAGCCATCTCTGCCACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080746.2-293s1c1
Sequence:CCGGCCGTATTTGTGCCAACAAATACTCGAGTATTTGTTGGCACAAATACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_080746.2-291s1c1
Sequence:CCGGGCCCGTATTTGTGCCAACAAACTCGAGTTTGTTGGCACAAATACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_080746.2-578s1c1
Sequence:CCGGGAAGATTCATATCTCCAAGAACTCGAGTTCTTGGAGATATGAATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080746.2-610s1c1
Sequence:CCGGCGAAGTTTAATGCTGACGAATCTCGAGATTCGTCAGCATTAAACTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080746.2-239s21c1
Sequence:CCGGCCACATGGTGTCTGATGAATACTCGAGTATTCATCAGACACCATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080746.2-370s21c1
Sequence:CCGGTCCATGTCATCCGCATCAACACTCGAGTGTTGATGCGGATGACATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_080746.2-194s1c1
Sequence:CCGGCCTGGGTAGAAAGAAGGCAAACTCGAGTTTGCCTTCTTTCTACCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080746.2-664s21c1
Sequence:CCGGCTGATGGTTGTGGAGTCAAGTCTCGAGACTTGACTCCACAACCATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080746.2-517s21c1
Sequence:CCGGAGAACGAGGAGCATGTGATTGCTCGAGCAATCACATGCTCCTCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080746.2-125s21c1
Sequence:CCGGTAAGAACAAGCCGTACCCAAACTCGAGTTTGGGTACGGCTTGTTCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080746.2-553s21c1
Sequence:CCGGCCAAGTTCAAGTTCCCTGGACCTCGAGGTCCAGGGAACTTGAACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080746.2-470s21c1
Sequence:CCGGCCGGGTCCACATTGGTCAAGTCTCGAGACTTGACCAATGTGGACCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080746
VALIDATED
RPL10L MISSION shRNA shRNA Plasmid DNA
ribosomal protein L10-like
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080746.2-325s21c1
Sequence:CCGGGTTGTGGCAGAGATGGCTTTCCTCGAGGAAAGCCATCTCTGCCACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080746.2-293s1c1
Sequence:CCGGCCGTATTTGTGCCAACAAATACTCGAGTATTTGTTGGCACAAATACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_080746.2-291s1c1
Sequence:CCGGGCCCGTATTTGTGCCAACAAACTCGAGTTTGTTGGCACAAATACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_080746.2-578s1c1
Sequence:CCGGGAAGATTCATATCTCCAAGAACTCGAGTTCTTGGAGATATGAATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080746.2-610s1c1
Sequence:CCGGCGAAGTTTAATGCTGACGAATCTCGAGATTCGTCAGCATTAAACTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080746.2-239s21c1
Sequence:CCGGCCACATGGTGTCTGATGAATACTCGAGTATTCATCAGACACCATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080746.2-370s21c1
Sequence:CCGGTCCATGTCATCCGCATCAACACTCGAGTGTTGATGCGGATGACATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_080746.2-194s1c1
Sequence:CCGGCCTGGGTAGAAAGAAGGCAAACTCGAGTTTGCCTTCTTTCTACCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080746.2-664s21c1
Sequence:CCGGCTGATGGTTGTGGAGTCAAGTCTCGAGACTTGACTCCACAACCATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080746.2-517s21c1
Sequence:CCGGAGAACGAGGAGCATGTGATTGCTCGAGCAATCACATGCTCCTCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080746.2-125s21c1
Sequence:CCGGTAAGAACAAGCCGTACCCAAACTCGAGTTTGGGTACGGCTTGTTCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080746.2-553s21c1
Sequence:CCGGCCAAGTTCAAGTTCCCTGGACCTCGAGGTCCAGGGAACTTGAACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080746.2-470s21c1
Sequence:CCGGCCGGGTCCACATTGGTCAAGTCTCGAGACTTGACCAATGTGGACCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080746
VALIDATED
RPL10L MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L10-like
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080746.2-325s21c1
Sequence:CCGGGTTGTGGCAGAGATGGCTTTCCTCGAGGAAAGCCATCTCTGCCACAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080746.2-293s1c1
Sequence:CCGGCCGTATTTGTGCCAACAAATACTCGAGTATTTGTTGGCACAAATACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_080746.2-291s1c1
Sequence:CCGGGCCCGTATTTGTGCCAACAAACTCGAGTTTGTTGGCACAAATACGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_080746.2-578s1c1
Sequence:CCGGGAAGATTCATATCTCCAAGAACTCGAGTTCTTGGAGATATGAATCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080746.2-610s1c1
Sequence:CCGGCGAAGTTTAATGCTGACGAATCTCGAGATTCGTCAGCATTAAACTTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080746.2-239s21c1
Sequence:CCGGCCACATGGTGTCTGATGAATACTCGAGTATTCATCAGACACCATGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080746.2-370s21c1
Sequence:CCGGTCCATGTCATCCGCATCAACACTCGAGTGTTGATGCGGATGACATGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_080746.2-194s1c1
Sequence:CCGGCCTGGGTAGAAAGAAGGCAAACTCGAGTTTGCCTTCTTTCTACCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080746.2-664s21c1
Sequence:CCGGCTGATGGTTGTGGAGTCAAGTCTCGAGACTTGACTCCACAACCATCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080746.2-517s21c1
Sequence:CCGGAGAACGAGGAGCATGTGATTGCTCGAGCAATCACATGCTCCTCGTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080746.2-125s21c1
Sequence:CCGGTAAGAACAAGCCGTACCCAAACTCGAGTTTGGGTACGGCTTGTTCTTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080746.2-553s21c1
Sequence:CCGGCCAAGTTCAAGTTCCCTGGACCTCGAGGTCCAGGGAACTTGAACTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080746.2-470s21c1
Sequence:CCGGCCGGGTCCACATTGGTCAAGTCTCGAGACTTGACCAATGTGGACCCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001162933
RPL10L MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L10-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162933.1-619s21c1
Sequence:CCGGCTGATGGCTGTGGAGTCAAATCTCGAGATTTGACTCCACAGCCATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162933.1-196s21c1
Sequence:CCGGACATGGTGTCGGACGAGTATGCTCGAGCATACTCGTCCGACACCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162933.1-677s21c1
Sequence:CCGGCCTGCATTCCTGAGGACTTTGCTCGAGCAAAGTCCTCAGGAATGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162933.1-163s21c1
Sequence:CCGGAGGCGAAGGTGGATGAGTTTCCTCGAGGAAACTCATCCACCTTCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162933.1-708s21c1
Sequence:CCGGAGAAGTACAGATGAGGTTATACTCGAGTATAACCTCATCTGTACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001162933
RPL10L MISSION shRNA shRNA Plasmid DNA
ribosomal protein L10-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162933.1-619s21c1
Sequence:CCGGCTGATGGCTGTGGAGTCAAATCTCGAGATTTGACTCCACAGCCATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162933.1-196s21c1
Sequence:CCGGACATGGTGTCGGACGAGTATGCTCGAGCATACTCGTCCGACACCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162933.1-677s21c1
Sequence:CCGGCCTGCATTCCTGAGGACTTTGCTCGAGCAAAGTCCTCAGGAATGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162933.1-163s21c1
Sequence:CCGGAGGCGAAGGTGGATGAGTTTCCTCGAGGAAACTCATCCACCTTCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162933.1-708s21c1
Sequence:CCGGAGAAGTACAGATGAGGTTATACTCGAGTATAACCTCATCTGTACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001162933
RPL10L MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L10-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162933.1-619s21c1
Sequence:CCGGCTGATGGCTGTGGAGTCAAATCTCGAGATTTGACTCCACAGCCATCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162933.1-196s21c1
Sequence:CCGGACATGGTGTCGGACGAGTATGCTCGAGCATACTCGTCCGACACCATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162933.1-677s21c1
Sequence:CCGGCCTGCATTCCTGAGGACTTTGCTCGAGCAAAGTCCTCAGGAATGCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162933.1-163s21c1
Sequence:CCGGAGGCGAAGGTGGATGAGTTTCCTCGAGGAAACTCATCCACCTTCGCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162933.1-708s21c1
Sequence:CCGGAGAAGTACAGATGAGGTTATACTCGAGTATAACCTCATCTGTACTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)