EMAIL THIS PAGE TO A FRIEND

RPL11

ribosomal protein L11

45 Gene Product Result for
Synonyms: DBA7 GIG34 L11
UniProtKB ID: P62913, P25121, P39026, Q8TDH2, Q9Y674
Gene ID:
Human(6135) Summary: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L5P family of ribosomal proteins. It is located in the cytoplasm. The protein probably associates with the 5S rRNA. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Dec 2010]
Mouse(67025) ribosomal protein L11
Rat(362631) ribosomal protein L11
fruit fly(37235) Ribosomal protein L11
chicken(419682) ribosomal protein L11
dog(100684296) ribosomal protein L11
domestic cat(100169947) ribosomal protein L11
Zebrafish(415229) ribosomal protein L11
domestic guinea pig(100714125) ribosomal protein L11
naked mole-rat(101713236) ribosomal protein L11
cow(512745) ribosomal protein L11
sheep(101120638) ribosomal protein L11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025919 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025919 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025919 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000975 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000975 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000975 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108131 MISSION® esiRNA esiRNA human RPL11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000975 Rosetta Predictions human pricing
NM_001025739 Rosetta Predictions rat pricing
NM_025919 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000975 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138294 predicted 271
2 SASI_Hs01_00138295 predicted 348
3 SASI_Hs01_00138297 predicted 388
4 SASI_Hs01_00138298 predicted 282
5 SASI_Hs01_00138299 predicted 354
6 SASI_Hs01_00138302 predicted 372
7 SASI_Hs01_00138303 predicted 213
8 SASI_Hs02_00303622 predicted 286
9 SASI_Hs02_00303623 predicted 268
10 SASI_Hs02_00303624 predicted 217
11 SASI_Hs01_00138296 predicted 319
12 SASI_Hs01_00138300 predicted 355
13 SASI_Hs01_00138301 predicted 353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025739 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085637 predicted 593
2 SASI_Rn01_00085638 predicted 666
3 SASI_Rn01_00085639 predicted 666
4 SASI_Rn01_00085640 predicted 370
5 SASI_Rn01_00085641 predicted 629
6 SASI_Rn01_00085642 predicted 369
7 SASI_Rn01_00085643 predicted 417
8 SASI_Rn02_00203377 predicted 665
9 SASI_Rn01_00085644 predicted 613
10 SASI_Rn01_00085645 predicted 638
11 SASI_Rn01_00085646 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025919 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329273 predicted 67
2 SASI_Mm02_00329274 predicted 103
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025919
VALIDATED
RPL11 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L11
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025919.2-317s21c1
Sequence:CCGGCGGATACTGGAAACTTTGGTTCTCGAGAACCAAAGTTTCCAGTATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025919.2-253s21c1
Sequence:CCGGGCAGAGGAAATTCTGGAGAAACTCGAGTTTCTCCAGAATTTCCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025919.2-69s21c1
Sequence:CCGGCCGCAAGCTCTGCCTCAATATCTCGAGATATTGAGGCAGAGCTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025919.2-286s21c1
Sequence:CCGGCGGGAGTATGAGTTGCGGAAACTCGAGTTTCCGCAACTCATACTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025919.2-205s21c1
Sequence:CCGGCGGAGAAATGAGAAGATTGCTCTCGAGAGCAATCTTCTCATTTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025919.1-71s1c1
Sequence:CCGGCCGCAAGCTCTGCCTCAATATCTCGAGATATTGAGGCAGAGCTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025919.1-288s1c1
Sequence:CCGGCGGGAGTATGAGTTGCGGAAACTCGAGTTTCCGCAACTCATACTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025919.1-255s1c1
Sequence:CCGGGCAGAGGAAATTCTGGAGAAACTCGAGTTTCTCCAGAATTTCCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025919.1-319s1c1
Sequence:CCGGCGGATACTGGAAACTTTGGTTCTCGAGAACCAAAGTTTCCAGTATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025919.1-207s1c1
Sequence:CCGGCGGAGAAATGAGAAGATTGCTCTCGAGAGCAATCTTCTCATTTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025919
VALIDATED
RPL11 MISSION shRNA shRNA Plasmid DNA
ribosomal protein L11
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025919.2-317s21c1
Sequence:CCGGCGGATACTGGAAACTTTGGTTCTCGAGAACCAAAGTTTCCAGTATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025919.2-253s21c1
Sequence:CCGGGCAGAGGAAATTCTGGAGAAACTCGAGTTTCTCCAGAATTTCCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025919.2-69s21c1
Sequence:CCGGCCGCAAGCTCTGCCTCAATATCTCGAGATATTGAGGCAGAGCTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025919.2-286s21c1
Sequence:CCGGCGGGAGTATGAGTTGCGGAAACTCGAGTTTCCGCAACTCATACTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025919.2-205s21c1
Sequence:CCGGCGGAGAAATGAGAAGATTGCTCTCGAGAGCAATCTTCTCATTTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025919.1-71s1c1
Sequence:CCGGCCGCAAGCTCTGCCTCAATATCTCGAGATATTGAGGCAGAGCTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025919.1-288s1c1
Sequence:CCGGCGGGAGTATGAGTTGCGGAAACTCGAGTTTCCGCAACTCATACTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025919.1-255s1c1
Sequence:CCGGGCAGAGGAAATTCTGGAGAAACTCGAGTTTCTCCAGAATTTCCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025919.1-319s1c1
Sequence:CCGGCGGATACTGGAAACTTTGGTTCTCGAGAACCAAAGTTTCCAGTATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025919.1-207s1c1
Sequence:CCGGCGGAGAAATGAGAAGATTGCTCTCGAGAGCAATCTTCTCATTTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025919
VALIDATED
RPL11 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L11
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025919.2-317s21c1
Sequence:CCGGCGGATACTGGAAACTTTGGTTCTCGAGAACCAAAGTTTCCAGTATCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025919.2-253s21c1
Sequence:CCGGGCAGAGGAAATTCTGGAGAAACTCGAGTTTCTCCAGAATTTCCTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025919.2-69s21c1
Sequence:CCGGCCGCAAGCTCTGCCTCAATATCTCGAGATATTGAGGCAGAGCTTGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025919.2-286s21c1
Sequence:CCGGCGGGAGTATGAGTTGCGGAAACTCGAGTTTCCGCAACTCATACTCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025919.2-205s21c1
Sequence:CCGGCGGAGAAATGAGAAGATTGCTCTCGAGAGCAATCTTCTCATTTCTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025919.1-71s1c1
Sequence:CCGGCCGCAAGCTCTGCCTCAATATCTCGAGATATTGAGGCAGAGCTTGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025919.1-288s1c1
Sequence:CCGGCGGGAGTATGAGTTGCGGAAACTCGAGTTTCCGCAACTCATACTCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025919.1-255s1c1
Sequence:CCGGGCAGAGGAAATTCTGGAGAAACTCGAGTTTCTCCAGAATTTCCTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025919.1-319s1c1
Sequence:CCGGCGGATACTGGAAACTTTGGTTCTCGAGAACCAAAGTTTCCAGTATCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025919.1-207s1c1
Sequence:CCGGCGGAGAAATGAGAAGATTGCTCTCGAGAGCAATCTTCTCATTTCTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000975
VALIDATED
RPL11 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L11
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000975.2-68s21c1
Sequence:CCGGCATCCGCAAACTCTGTCTCAACTCGAGTTGAGACAGAGTTTGCGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000975.2-311s21c1
Sequence:CCGGCAACTTCTCAGATACTGGAAACTCGAGTTTCCAGTATCTGAGAAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000975.2-180s21c1
Sequence:CCGGAGATACACTGTCAGATCCTTTCTCGAGAAAGGATCTGACAGTGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_000975.2-71s1c1
Sequence:CCGGCCGCAAACTCTGTCTCAACATCTCGAGATGTTGAGACAGAGTTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000975.2-68s1c1
Sequence:CCGGCATCCGCAAACTCTGTCTCAACTCGAGTTGAGACAGAGTTTGCGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_000975.2-287s1c1
Sequence:CCGGGCGGGAGTATGAGTTAAGAAACTCGAGTTTCTTAACTCATACTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000975.2-180s1c1
Sequence:CCGGAGATACACTGTCAGATCCTTTCTCGAGAAAGGATCTGACAGTGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000975.2-311s1c1
Sequence:CCGGCAACTTCTCAGATACTGGAAACTCGAGTTTCCAGTATCTGAGAAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000975.2-287s21c1
Sequence:CCGGGCGGGAGTATGAGTTAAGAAACTCGAGTTTCTTAACTCATACTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000975
VALIDATED
RPL11 MISSION shRNA shRNA Plasmid DNA
ribosomal protein L11
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000975.2-68s21c1
Sequence:CCGGCATCCGCAAACTCTGTCTCAACTCGAGTTGAGACAGAGTTTGCGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000975.2-311s21c1
Sequence:CCGGCAACTTCTCAGATACTGGAAACTCGAGTTTCCAGTATCTGAGAAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000975.2-180s21c1
Sequence:CCGGAGATACACTGTCAGATCCTTTCTCGAGAAAGGATCTGACAGTGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_000975.2-71s1c1
Sequence:CCGGCCGCAAACTCTGTCTCAACATCTCGAGATGTTGAGACAGAGTTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000975.2-68s1c1
Sequence:CCGGCATCCGCAAACTCTGTCTCAACTCGAGTTGAGACAGAGTTTGCGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_000975.2-287s1c1
Sequence:CCGGGCGGGAGTATGAGTTAAGAAACTCGAGTTTCTTAACTCATACTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000975.2-180s1c1
Sequence:CCGGAGATACACTGTCAGATCCTTTCTCGAGAAAGGATCTGACAGTGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000975.2-311s1c1
Sequence:CCGGCAACTTCTCAGATACTGGAAACTCGAGTTTCCAGTATCTGAGAAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000975.2-287s21c1
Sequence:CCGGGCGGGAGTATGAGTTAAGAAACTCGAGTTTCTTAACTCATACTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000975
VALIDATED
RPL11 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L11
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000975.2-68s21c1
Sequence:CCGGCATCCGCAAACTCTGTCTCAACTCGAGTTGAGACAGAGTTTGCGGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000975.2-311s21c1
Sequence:CCGGCAACTTCTCAGATACTGGAAACTCGAGTTTCCAGTATCTGAGAAGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000975.2-180s21c1
Sequence:CCGGAGATACACTGTCAGATCCTTTCTCGAGAAAGGATCTGACAGTGTATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_000975.2-71s1c1
Sequence:CCGGCCGCAAACTCTGTCTCAACATCTCGAGATGTTGAGACAGAGTTTGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000975.2-68s1c1
Sequence:CCGGCATCCGCAAACTCTGTCTCAACTCGAGTTGAGACAGAGTTTGCGGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_000975.2-287s1c1
Sequence:CCGGGCGGGAGTATGAGTTAAGAAACTCGAGTTTCTTAACTCATACTCCCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000975.2-180s1c1
Sequence:CCGGAGATACACTGTCAGATCCTTTCTCGAGAAAGGATCTGACAGTGTATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000975.2-311s1c1
Sequence:CCGGCAACTTCTCAGATACTGGAAACTCGAGTTTCCAGTATCTGAGAAGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000975.2-287s21c1
Sequence:CCGGGCGGGAGTATGAGTTAAGAAACTCGAGTTTCTTAACTCATACTCCCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)