EMAIL THIS PAGE TO A FRIEND

RPL17

ribosomal protein L17

37 Gene Product Result for
Synonyms: L17 PD-1 RPL23
Gene ID:
Human(6139) Summary: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L22P family of ribosomal proteins. It is located in the cytoplasm. This gene has been referred to as rpL23 because the encoded protein shares amino acid identity with ribosomal protein L23 from Halobacterium marismortui; however, its official symbol is RPL17. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream C18orf32 (chromosome 18 open reading frame 32) gene. [provided by RefSeq, Dec 2010]
Mouse(319195) ribosomal protein L17
Rat(291434) ribosomal protein L17
fruit fly(31613) Ribosomal protein L17
dog(475077) 60S ribosomal protein L17-like
Horse(100034005) ribosomal protein L17
domestic cat(100169966) ribosomal protein L17
dog(480221) ribosomal protein L17
Zebrafish(336641) ribosomal protein L17
cow(514046) ribosomal protein L17
Goat(100861018) ribosomal protein L17
naked mole-rat(101720109) ribosomal protein L17
Domestic Rabbit(100008824) ribosomal protein L17
domestic guinea pig(100725672) ribosomal protein L17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000985 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000985 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000985 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001002239 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001002239 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001002239 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU217571 MISSION® esiRNA esiRNA targeting mouse Rpl17 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000985 Rosetta Predictions human pricing
NM_001035006 Rosetta Predictions human pricing
NM_201415 Rosetta Predictions rat pricing
NM_001002239 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000985 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303657 predicted 706
2 SASI_Hs02_00303658 predicted 704
3 SASI_Hs01_00144497 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308168 predicted 459
2 SASI_Hs02_00308169 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201415 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270299 predicted 209
2 SASI_Rn02_00270300 predicted 193
3 SASI_Rn02_00270301 predicted 212
4 SASI_Rn02_00270302 predicted 157
5 SASI_Rn02_00270303 predicted 28
6 SASI_Rn02_00270304 predicted 29
7 SASI_Rn02_00270305 predicted 127
8 SASI_Rn02_00270306 predicted 111
9 SASI_Rn02_00270307 predicted 64
10 SASI_Rn02_00270308 predicted 81
11 SASI_Rn01_00079014 predicted 349
12 SASI_Rn01_00079015 predicted 361
13 SASI_Rn01_00079016 predicted 361
14 SASI_Rn01_00079017 predicted 354
15 SASI_Rn01_00079018 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002239 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286278 predicted 308
2 SASI_Mm02_00286279 predicted 274
3 SASI_Mm01_00086662 predicted 722
4 SASI_Mm01_00086663 predicted 726
5 SASI_Mm01_00086664 predicted 711
6 SASI_Mm01_00086665 predicted 701
7 SASI_Mm01_00086666 predicted 698
8 SASI_Mm01_00086667 predicted 691
9 SASI_Mm01_00086668 predicted 709
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000985
VALIDATED
RPL17 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L17
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000985.3-471s21c1
Sequence:CCGGGCCACGAAGTATCTGAAAGATCTCGAGATCTTTCAGATACTTCGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000985.3-522s21c1
Sequence:CCGGCGACGTTACAATGGTGGAGTTCTCGAGAACTCCACCATTGTAACGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000985.3-692s21c1
Sequence:CCGGCCAAGTGAACAAAGCACCTAACTCGAGTTAGGTGCTTTGTTCACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000985.3-633s21c1
Sequence:CCGGGCAGAGAGTAATGCTGAACTTCTCGAGAAGTTCAGCATTACTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000985.2-416s1c1
Sequence:CCGGGCCACGAAGTATCTGAAAGATCTCGAGATCTTTCAGATACTTCGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000985.2-467s1c1
Sequence:CCGGCGACGTTACAATGGTGGAGTTCTCGAGAACTCCACCATTGTAACGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000985.2-578s1c1
Sequence:CCGGGCAGAGAGTAATGCTGAACTTCTCGAGAAGTTCAGCATTACTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000985.2-318s1c1
Sequence:CCGGCCACGAAATCATGCAAATCAACTCGAGTTGATTTGCATGATTTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000985.2-637s1c1
Sequence:CCGGCCAAGTGAACAAAGCACCTAACTCGAGTTAGGTGCTTTGTTCACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000985
VALIDATED
RPL17 MISSION shRNA shRNA Plasmid DNA
ribosomal protein L17
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000985.3-471s21c1
Sequence:CCGGGCCACGAAGTATCTGAAAGATCTCGAGATCTTTCAGATACTTCGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000985.3-522s21c1
Sequence:CCGGCGACGTTACAATGGTGGAGTTCTCGAGAACTCCACCATTGTAACGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000985.3-692s21c1
Sequence:CCGGCCAAGTGAACAAAGCACCTAACTCGAGTTAGGTGCTTTGTTCACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000985.3-633s21c1
Sequence:CCGGGCAGAGAGTAATGCTGAACTTCTCGAGAAGTTCAGCATTACTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000985.2-416s1c1
Sequence:CCGGGCCACGAAGTATCTGAAAGATCTCGAGATCTTTCAGATACTTCGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000985.2-467s1c1
Sequence:CCGGCGACGTTACAATGGTGGAGTTCTCGAGAACTCCACCATTGTAACGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000985.2-578s1c1
Sequence:CCGGGCAGAGAGTAATGCTGAACTTCTCGAGAAGTTCAGCATTACTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000985.2-318s1c1
Sequence:CCGGCCACGAAATCATGCAAATCAACTCGAGTTGATTTGCATGATTTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000985.2-637s1c1
Sequence:CCGGCCAAGTGAACAAAGCACCTAACTCGAGTTAGGTGCTTTGTTCACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000985
VALIDATED
RPL17 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L17
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000985.3-471s21c1
Sequence:CCGGGCCACGAAGTATCTGAAAGATCTCGAGATCTTTCAGATACTTCGTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000985.3-522s21c1
Sequence:CCGGCGACGTTACAATGGTGGAGTTCTCGAGAACTCCACCATTGTAACGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000985.3-692s21c1
Sequence:CCGGCCAAGTGAACAAAGCACCTAACTCGAGTTAGGTGCTTTGTTCACTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000985.3-633s21c1
Sequence:CCGGGCAGAGAGTAATGCTGAACTTCTCGAGAAGTTCAGCATTACTCTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000985.2-416s1c1
Sequence:CCGGGCCACGAAGTATCTGAAAGATCTCGAGATCTTTCAGATACTTCGTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000985.2-467s1c1
Sequence:CCGGCGACGTTACAATGGTGGAGTTCTCGAGAACTCCACCATTGTAACGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000985.2-578s1c1
Sequence:CCGGGCAGAGAGTAATGCTGAACTTCTCGAGAAGTTCAGCATTACTCTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000985.2-318s1c1
Sequence:CCGGCCACGAAATCATGCAAATCAACTCGAGTTGATTTGCATGATTTCGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000985.2-637s1c1
Sequence:CCGGCCAAGTGAACAAAGCACCTAACTCGAGTTAGGTGCTTTGTTCACTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002239
RPL17 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L17
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002239.1-328s1c1
Sequence:CCGGGCTGAGAGTAACGCTGAACTTCTCGAGAAGTTCAGCGTTACTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002239.1-483s1c1
Sequence:CCGGCCTCACTGAGAAGGAACAGATCTCGAGATCTGTTCCTTCTCAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002239.1-217s1c1
Sequence:CCGGCGGCGGTATAATGGTGGAGTTCTCGAGAACTCCACCATTATACCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002239.1-166s1c1
Sequence:CCGGGCCACCAAGTATCTGAAGGATCTCGAGATCCTTCAGATACTTGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002239.1-77s1c1
Sequence:CCGGCATGCAAATCAAGAGGGTCAACTCGAGTTGACCCTCTTGATTTGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002239
RPL17 MISSION shRNA shRNA Plasmid DNA
ribosomal protein L17
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002239.1-328s1c1
Sequence:CCGGGCTGAGAGTAACGCTGAACTTCTCGAGAAGTTCAGCGTTACTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002239.1-483s1c1
Sequence:CCGGCCTCACTGAGAAGGAACAGATCTCGAGATCTGTTCCTTCTCAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002239.1-217s1c1
Sequence:CCGGCGGCGGTATAATGGTGGAGTTCTCGAGAACTCCACCATTATACCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002239.1-166s1c1
Sequence:CCGGGCCACCAAGTATCTGAAGGATCTCGAGATCCTTCAGATACTTGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002239.1-77s1c1
Sequence:CCGGCATGCAAATCAAGAGGGTCAACTCGAGTTGACCCTCTTGATTTGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002239
RPL17 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L17
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002239.1-328s1c1
Sequence:CCGGGCTGAGAGTAACGCTGAACTTCTCGAGAAGTTCAGCGTTACTCTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002239.1-483s1c1
Sequence:CCGGCCTCACTGAGAAGGAACAGATCTCGAGATCTGTTCCTTCTCAGTGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002239.1-217s1c1
Sequence:CCGGCGGCGGTATAATGGTGGAGTTCTCGAGAACTCCACCATTATACCGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002239.1-166s1c1
Sequence:CCGGGCCACCAAGTATCTGAAGGATCTCGAGATCCTTCAGATACTTGGTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002239.1-77s1c1
Sequence:CCGGCATGCAAATCAAGAGGGTCAACTCGAGTTGACCCTCTTGATTTGCATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)